answersLogoWhite

0

Subjects>Science>Biology

What is an alloform?

User Avatar

Bobo192 ∙

Lvl 1
∙ 11y ago
Updated: 6/21/2024

An alloform is a distinct form of something treated as a single kind or species.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Continue Learning about Biology
Related Questions
Trending Questions
The scientific method uses observation and what other process? What does dominant heterogeneous culture means? What does the acronym BYTE mean? Can you transmit tonsillitis from sex? What are The organic compounds that function in building tissues and acting as enzymes? What is the difference between a faculatative anaerobe and a microaerophile? How did the tulip poplar become Tennessees state tree? Abnormal tube like passageway in the distal end of the alimentary tract? In the human body is there really a bone named funny bone? Is gram-positive cell wall sensitive to lysozyme? Meaning of dendrology? What do you call an individual toe? Does ice cream have bones? What is the structure and classification of bone tissue? What is the use of asbestos signs? What is the scientific name for roots? What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa? Does the glossary come first or the appendix? What is the main cell type in skin? What is the source of polygonal cell?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.