0
What else can I help you with?
Continue Learning about Biology
Related Questions
Is centride a plant or animal cell?
A centride is found in both.
What is the function of centride?
its is a oten
What does a centride do?
A centride has spindle fibers attached to it that lengthen to reach the chromosomes. The centrides also move towards opposite ends of a cell around the middle of the cell cycle.
What is the definition of a centride?
A centride is a point in a triangular diagram that represents the center of mass of the three components or variables being considered. It is often used in geology to analyze the composition of rocks or minerals.
Trending Questions
What is the significance of the presence of wasps in Illinois and how do they impact the local ecosystem?
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
What is the biggest organ on the outside?
What solution that causes a cell to swell cause of osmosis?
In a Punnett square a capital letter stands for a allele.?
Is spotted knapweed poisonous to humans?
What are sme questions scientists still have about endosymbiosis?
What is a two word name for every organism?
Which of the following could be described as a chromosomal mutation?
What does a bottle and a knee have in common?
What pigment gives skin color?
What is the higher levels than an organism?
Who plays Bruce in us cellular commercials?
How do blood vessels in the eye affect vision and overall eye health?
How do you not studder?
Within limits increasing the temperature within a cell causes more enzyme-catalyzed reaction to occur?
What piece of equipment should be used to transfer a protists onto a microscope slide?
What part of a humans body makes protein?
What biomes are in Louisiana?
What gland is called the master gland that is located at base of brain and controls growth of sex cells and most of the other glands?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.