0
What else can I help you with?
Continue Learning about Biology
Related Questions
Trending Questions
What is a human analogy to a lysosome?
What kind of tree keeps leaves all winter?
How do you pronounce "chey"?
Any trace of a ancient organism preserved in rock is called?
What is a ipsilateral reflex arc?
How long does dubble bubble gum last?
What determines a cell's shape?
Is it possible for an XY embryo to develop as a female if the SRY gene on the Y chromosome is not present?
Why do whales make sounds?
What major artery carries oxygen-rich blood?
What is the role of the hair follicle in the growth and maintenance of hair?
What characteristics of water help support life?
The junction between separated strands of DNA is called what?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What is the end result of mitosis and cytokinesis?
Which part of the body is affected by the disease known as eczema?
What are the differences between Queen Anne's lace and wild parsnip in terms of appearance, habitat, and potential risks to humans and animals?
What is apparatus and is it like a tool or equipment?
In an emergency, in which direction can ATP synthase pump for a limited amount of time?
What are some traits about gebu?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.