answersLogoWhite

0

Subjects>Science>Biology

What is penstrep?

User Avatar

Anonymous

∙ 17y ago
Updated: 6/9/2024

Pen-Strep is a mixture of Penicillin and Streptomycin used in cell cultures to as an antibiotic.

User Avatar

Wiki User

∙ 17y ago
Copy

What else can I help you with?

Continue Learning about Biology
Related Questions
Trending Questions
Is a turtle a reptile or an amphibian? What does the word aaicbter mean in unscramble? What is coadaptation? An oil secretion that helps to waterproof body surface? What causes a cyst on the finger? What is the difference in plant cells and animal cells? How do bands of muscle contribute to the overall strength and function of the human body? What does it mean to have too much protein in your blood? Are outcomes of binomial experiment dependent on each other? What is the average annual salary made by a marine biologist? What if your neck is darker than your body? What are the complementary bases for the following DNA strand aatggccttagcagttgcatga? What is the most light sensitive receptor cells? What is the structure of blood? What are the benefits of using bacteria and plant starch to create plastic? What is an examination of the body after death usually with dissection as will expose the vital organs? Seeds dispersed by fire and their plants name? Midnight zone animals? Why is the sodium-potassium pump called an electrogenic pump? Can dogs get styes on their eyelids?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.