Tags Biology Human Anatomy and Physiology Genetics

Animals & Plants Arts & Entertainment Auto Beauty & Health Books and Literature Business Electronics Engineering & Technology Food & Drink History Hobbies Jobs & Education Law & Government Math People & Society Science Social Studies Sports Travel & Places

0

Subjects>Science>Biology

What is the complementary-strand of 3'-ATTCGACC?

Updated: 8/10/2023

Wiki User

∙ 14y ago

Best Answer

5' taagctgg 3'

Wiki User

∙ 14y ago

This answer is:

More answers

Wiki User

∙ 11y ago

3' TATCGG 5'

This answer is:

Khloe Hart ∙

Lvl 2

∙ 3y ago

adenine thymine cytosine guanine

This answer is:

Alison Webb ∙

Lvl 2

∙ 3y ago

TAGCACGCACTATAAAGCTCA

This answer is:

Wiki User

∙ 11y ago

TAACGGGTAC

This answer is:

Add your answer:

Earn +20 pts

Q: What is the complementary-strand of 3'-ATTCGACC?

Write your answer...

Submit

Still have questions?

imp

Continue Learning about Biology

Related questions

Trending Questions

Does Olfaction result from the stimulation of chemoreceptors? What did howard florey study? Most body odor is the result of bacterial metabolism of the secretions produced by? What are the six qualities included in a description of colony morphology? What is a physioligist? What is the relationship between double helix and chromosome? The point of communication between two neurons? Why is haemophilia a lethal gene in its homozygous state? Part of the cell cycle usually accompanied by cell division? What state you can't get married in with an STD? Neuron connecting sensory and motor neurons? The movable disc to which the objectives are attached? Which phrase best describes the function of the ATP molecule? What is silver leaf? What is biopsychology? What is sixsixs code? The bird has brown spots on its wings is an example of what? What is a combination of two or more electrochemical cells in a series called? What is most likely happening in this sentence? Who discovered ehlers-danlos syndrome?

Still have questions?

imp

Previously Viewed

What is the complementary-strand of 3'-ATTCGACC?

Resources

Top Categories

Product

Company

Copyright ©2024 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.