0
DNA
Lupe Hahn
June Douglas
a mutation
Wiki User
∙ 12y agoI believe you mean a "mutation"
there are dfferent types of mutations: deletion, addition, and swapping places in a dna strand
ex: original strand: ATGCCTAGTCAGATCCCG
addition (in bold): ATGCCTAGTCAGATCCCGAC
deletion(cross out): ATGCCTAGTCAGATCCCG
swapping: ATGCCTAGTCAGATCCCG = ATGCAGCTTCAGATCCCG (see how CT and AG were switched?)
(bold italics and bold)
Wiki User
∙ 13y agomutated
Wiki User
∙ 15y agoA genie
Add your answer:
Earn +20 pts
What chemical found in a gene is changed by mutation?
DNA
Was Gene Pitney blind?
carl said yes
A mutation that involves a single nucleotide is called a(an)?
Point Mutation- a type of gene mutation in which only a single nucleotide in a gene has been changed.
A gene that may not show up even though it is there is said to be-?
A gene that may not show up even if it has been passed down is a recessive gene.
When a gene inherited from one parent masks the expression of the gene inherited from the other parent that gene is said to be?
A gene whose phenotypic expression is masked by the presence of another is generally called the recessive gene. However, it can still be passed onto offspring.
What is it called when an entire gene moves to another location?
answer sh*t please smart people
What is a changed gene?
mutated
What chemical found in a gene is changed by mutation?
DNA
When one gene expresses itself over another the former gene is said to be the?
Recessive
What is Gene simmons real name?
Chaim Witz was his original name, but he has changed it to Gene Simmons.
What is a different form of gene?
The answer is an allele. I hope your not cheating on a fill-in-the blank biology worksheet. ;) It's alright. That's why I changed this because it said, "Your mom". That's not the right answer.
When one gene expresses itself over another the former gene is said to be the DNA?
The gene that expresses itself over the other is Dominant. The former gene is recessive.
Which helps Knowles show how gene changed over time?
flashback
Which helps Knowles show how gene had changed over time?
flashback
Was Gene Pitney blind?
carl said yes
A gene is recessive when?
Most genes have two copies of each gene with dominant gene "trumping" the recessive one. The gene is recessive because it is said not to do much of anything unless paired with another recessive gene, but if paired with a dominant gene, the dominant gene wins.
A mutation that involves a single nucleotide is called a(an)?
Point Mutation- a type of gene mutation in which only a single nucleotide in a gene has been changed.
