answersLogoWhite

0

I'll make this as easy to understand as I can. There are two different ways that daughter cells can form. Mitosis, and Meiosis I. That's all.

User Avatar

Wiki User

16y ago

What else can I help you with?

Related Questions

When a cell divides it form two?

daughter cells


Why do chromosomes replicate?

They replicate to form two identical daughter cells.


When is cytokinesis complete?

It is complete when two daughter cells are produced. Cytokinesis is the process in which the cytoplasm of a single cell divides to form two daughter cells.


How does the the furrow form in the animal cell?

a daughter cell pinch into two cells


These cells use mitosis to divide into two daughter cells?

Both plant and animal cells use mitosis to form two daughter cells. They are usually called soma (body) cells but there are some exceptions: nerve cells and liver cells. The liver cells can divide in the time of need.


What type of daughter cells does meiosis form?

haploid daughter cells.


What is the process of the cells division in which one mother cell divides to form two identical daughter cells?

osmosis


Two complete daughter cells are formed in what phase of meiosis?

Two complete daughter cells are formed in Meiosis II. Meiosis II follows Meiosis I where the two daughter cells produced by Meiosis I undergo further division to form a total of four haploid daughter cells.


When mitosis is complete how many daughter cell are there?

When mitosis is complete two diploid daughter cells are formed.


Does mitosis end in two cells?

Mitosis followed by cytokinesis produces two daughter cells.


Form between two daughter cells at the end of telophase in plant cell mitosis?

A cell plate forms between two daughter cells at the end of telophase in plant cell mitosis. This cell plate eventually develops into a new cell wall, separating the two daughter cells.


Do all eukaryotes same cytokinesis?

No, eukaryotes can have different methods of cytokinesis. In animal cells, cytokinesis involves the cleavage of the cell membrane to form two daughter cells. In plant cells, a cell plate forms between the daughter nuclei to separate the two cells.

Trending Questions
How do fungi use carbon dioxide? What is the medical term meaning blood abnormality that results from uncontrolled production of abnormal white blood cells by the bone marrow? What is the average temperature in a tropical dry forest? Can you get worms from eating pork? What causes high sodium levels in the blood? Which of the following values could possibly be vector magnitudes meaning that combined with a direction they could become vector quanities? Why cant patterns of in heritance in humans be easily studied as in peas or fruit flies? What are the four stages of focused listening? What organs are under your ribs? What are the complementary bases for the following DNA strand aatggccttagcagttgcatga? What happens to the cell when more water leaves the cell than enters it? Why did my plant die when I fed it Ribena which is supposed to be good for plants? What is the meaning of curiosify and fasienation? Can an octopus live on land and if so, how does it adapt to its new environment? Ear lobes can be either attached or detached the allele for attached earlobes is recessive and the allele for detached earlobes is dominant what must be true if a boy is born with attached your lobes? Do palate expanders hurt? Is the sunlight a nonliving or living thing? What is the major thing happening to a cell during G1? How is active transport different from facilitated diffusion in terms of the energy requirement for moving molecules across the cell membrane? How much bacteria does dove soap kill?