answersLogoWhite

0

Taking a quality nutritional supplement that actually treats the problems that cause fatigue, instead of just treating the symptoms like everything else. Give Vigor-XT a try. It's at www.VigorXT.com

All of the above. Getting proper rest, eating a properly balanced diet, obtaining enough sunshine (Vitamin D), limiting stress, exercising regularly and taking care of any underlying medical conditions. Fatigue is often made worse by illnesses like depression, autoimmune disorders, cancer, pharmaceutical drugs and stress.

User Avatar

Wiki User

16y ago

What else can I help you with?

Continue Learning about Biology
Related Questions

The best way to prevent fatigue on long drives is to?

To prevent the fatigue you have to reduce the amount of driving time. On a long distance the best way to avoid the fatigue is driving no more then eight hours in the row.


What can you do to help prevent fatigue while driving?

Pull over every 2 hours for five min to have a stretch. It can be a pee break or something.


What are the benefits of anti-fatigue mats in the workplace?

The benefits of anti-fatigue mats in the workplace is that it helps prevent slips and falls. Its a safety precaution and it often required in the work guidelines to prevent injuries in the workplace.


Are fatigue mats useful in the workplace?

These fatigue mats are designed to help people reduce their tension. These mats would help you in a position where you stand a lot.


What are the benefits of consuming a carbohydrate shake before a workout?

Consuming a carbohydrate shake before a workout can provide quick energy for your muscles, improve performance during exercise, and help prevent fatigue.


What causes wrist fatigue?

Wrist fatigue can be caused by repetitive motion, poor ergonomics, excessive use of electronic devices, or underlying medical conditions such as carpal tunnel syndrome or tendinitis. It is important to take breaks, adjust your workspace ergonomics, and practice proper wrist positioning to prevent fatigue. Stretching exercises and strengthening the muscles surrounding the wrist can also help alleviate fatigue.


Does a seatbelt prevent neck fatigue?

A seatbelt does not specifically prevent neck fatigue; its primary purpose is to enhance safety by restraining occupants during a collision. However, wearing a seatbelt can promote better posture and alignment while seated, potentially reducing strain on the neck during long drives. Additionally, a properly adjusted headrest can help support the neck and minimize discomfort. Ultimately, while a seatbelt contributes to overall safety, it may not directly address issues of neck fatigue.


How do I use anti fatigue mats?

These anti fatigue mats are designed to help people reduce fatigue. This is done by drawing tension from muscles and helping people become relaxed.


Does+vitamin+B+really+help+prevent+fatigue%3F?

Yes it can help a lot. I got some tried it on myself and it helped. I tried it because the vet gives the animals a B vit shot when they don't fee well to help perk them up. Yes, vitamin b helps to prevent fatique and anemia, this is especially true with vitamins b6 and b12. Yes, my mom swears by it and uses a sublingual form that disolves under the tongue Yes and no. Vitamin B12 has been known to be used to treat fatigue, but only in people who are B12 deficient.


What are some ways that you can prevent fatigue when driving on long trips?

Coffee . Smoke a big cigar.


What vitamin should you take to help fatigue?

b vitamins


Which retailers sell a fatigue mat?

Fatigue mats can help with pain from walking but mostly they help with pain from standing in the same spot for a lengthy period of time. Anti-fatigue mats can be purchased from Home Depot, Lowe's, Office Depot, Staples, and Wal Mart.

Trending Questions
The relaxation phase of the heartbeat is called? Endocrine organ rides horseback on the thyroid gland? How are enzymes created and what is their role in biological processes? What color hair and eyes will your baby have the mother has blonde hair and blue eyes and the father has brown hair and green eyes? What is a sentence using the word protein? Investigatory project example on how to use the natural garlic as pesticides? Explain how crossing over can unlink genes? What are the complementary bases for the following DNA strand aatggccttagcagttgcatga? What are Functions of blood tissues? How does the stranger interaction with elisa at her garden differ from henrys interaction with her at her garden? What is the morphology and arrangemen of bacillus subtilis under microscope? Does yogurt stain gram positive or gram negative? A student crosses two true-breeding pea plants one with green pods and the other with yellow pods. If yellow is dominant over green what phenotypic results will the student find in the F1 generation? Do you really inherit eye color from your parents? What is the definition for cell differation? Is the vagus nerve sympathetic or parasympathetic? What is the function of a lysosome in cellular processes? What is the protective structure of aloe vera? During glycolosis when glucose is catabolized to pyruvate most of the energy of glucose is? What cells engulf antigens and present fragments of them on their own surfaces where they can be recognized by cells that will deal with them?