0

Subjects>Science>Chemistry

What will be the state of sodium at 25 degrees celsius?

Anonymous

∙ 8y ago

Updated: 6/6/2024

Sodium is a solid at room temperature (25 degrees Celsius), as it has a melting point of 97.8 degrees Celsius. So, at 25 degrees Celsius, sodium will be in its solid state.

AnswerBot

∙ 1y ago

What else can I help you with?

Continue Learning about Chemistry

What is the state of sodium at 25 degrees Celsius?

Sodium is a solid at 25 degrees Celsius. Sodium has a melting point of 97.8 degrees Celsius, so it remains in a solid state at room temperature.

What state will nitrogen be at 25 celsius?

Nitrogen will be in a gaseous state at 25 degrees Celsius. Nitrogen has a boiling point of -195.8 degrees Celsius, so at 25 degrees Celsius it will remain a gas.

What is phenol's state at 25 degrees Celsius?

Phenol is a solid at 25 degrees Celsius.

What is helium's state at 25 degrees Celsius?

Helium is a gas at 25 degrees Celsius.

What state of matter is mercury at 25 degrees celsius?

Mercury is a liquid at 25 degrees Celsius.

Related Questions

What is the state of sodium at 25 degrees Celsius?

Sodium is a solid at 25 degrees Celsius. Sodium has a melting point of 97.8 degrees Celsius, so it remains in a solid state at room temperature.

What is Sodium's state at 25 degrees?

Solid white silvery soft metal. Usually stored in kerosene to avoid reaction with water vapor.

What state is rubidium at in 25 degrees celsius?

Rubidium is a solid at 25 degrees celsius. It has a melting point of 39.3 degrees celsius, so at 25 degrees celsius, it would be in a solid state.

What is the state of rubidium at 25 degrees celsius?

At 25 degrees Celsius, rubidium is a solid. Rubidium has a melting point of 39.3 degrees Celsius, so at 25 degrees Celsius, it would be in its solid state.

Is mercury state physical at 25 degrees Celsius?

Mercury's state at 25 degrees Celsius is liquid.

What state will nitrogen be at 25 celsius?

Nitrogen will be in a gaseous state at 25 degrees Celsius. Nitrogen has a boiling point of -195.8 degrees Celsius, so at 25 degrees Celsius it will remain a gas.

Hydrogen's state of matter at 25 degrees Celsius?

Hydrogen is a gas at 25 degrees Celsius.

What is phenol's state at 25 degrees Celsius?

Phenol is a solid at 25 degrees Celsius.

What is helium's state at 25 degrees Celsius?

Helium is a gas at 25 degrees Celsius.

What is the state of rubidiumat 25 degrees Celsius?

Rubidium is a solid at 25 degrees Celsius.

What state of matter is mercury at 25 degrees celsius?

Mercury is a liquid at 25 degrees Celsius.

What is the state of zinc at 25 degrees Celsius?

Zinc is a solid at 25 degrees Celsius.

Trending Questions

Does titanium freeze? How is heat included in the equation of an exothermic reaction? What are smiggle water bottles made from? In Arkansas What is 120 degrees Celsius? Is zirconium solid or liquid or gas? Is apples a strong acid? How many moles are in a 7.30 cm X 7.30 cm X 7.30 cm cube of copper? What Stuff is made of oil? What is the correct complementary DNA starnd for gacatcgttgactacggctgatc? What is a balanced equation for the decomposition of copper sulfate pentahydrate? How much THC in one gram of weed? What temp does ammonia liquid turn into gas? What color tube is used for cpk? What does compession mean? Which gland is associated with the production of epinephrine and norepinephrine two hormones that are associated with s? What is the structural formula for HCl? What is a neutralzation reaction? How can I achieve a patina on copper? What are the steps involved in Note-Making? What is the chemical name of NCI3?

Resources

Top Categories

Product

Company

Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.