-Insertions
-Deletions
-Replacements
-Flips
•AAATTGCTACGTCGATCGATCGGCCT
•AAATTGCTACGTCGATGATCGGCCT
•AAATTGCTAGCGTCGATCGATCGGCCT
•AAATTGCTACGTCGATCGCTCGGCCT
•AATATGCTACGTCGATCGATCGGCCT
yes
awsome :) iLy
There's many different genetic disorders such as: Down Syndrom Canavan Disease Muenke Syndrome Bloom Syndrome etc
yes, they may have the genetic diseases in their family.
how is it possible for a person to have dominant genetic disorder? how is it possible for a person to have dominant genetic disorder?
Jack H. Jung has written: 'Genetic syndromes in communication disorders' -- subject(s): Genetic disorders, Genetics, Genetic aspects, Communicative disorders, Inborn Genetic Diseases, Communication Disorders
There are thousands of known genetic disorders, estimated to be around 6,000-8,000. These disorders can range from single-gene mutations, to chromosomal abnormalities, to multifactorial disorders influenced by both genetic and environmental factors. Many genetic disorders are rare, affecting less than 1 in 2,000 individuals.
There are many but in cases there are none.
Several genetic disorders are caused by genes on the X chromosomes.
Genetic disorders are caused by abnormalities in an individual's DNA, either through mutations or changes in the genes. These abnormalities can be inherited from parents or can occur spontaneously during a person's lifetime. Genetic disorders can affect various aspects of health and development.
Getting into a collision accident will sometimes do it.Overuse of medications.Overuse of alcohol or drugs.Smoking overuse.Certain genetic disorders.
Two genetic disorders are Turner's syndrome and cystic fibrosis.
A genetic physician or a geneticist.
The causes of genetic disorders areThey can be inherited through Parents;Mutations may occur;A deletion may occur.These are the causes of a genetic disorder.
currently there are no treatments for genetic disorders
Over 30 different disorders of fat metabolism are related to genetic defects.
-Extra, missing or damaged chromosomes could show the presence of genetic disorders.