answersLogoWhite

0

-Insertions

-Deletions

-Replacements

-Flips

•AAATTGCTACGTCGATCGATCGGCCT

•AAATTGCTACGTCGATGATCGGCCT

•AAATTGCTAGCGTCGATCGATCGGCCT

•AAATTGCTACGTCGATCGCTCGGCCT

•AATATGCTACGTCGATCGATCGGCCT

User Avatar

Wiki User

11y ago

What else can I help you with?

Related Questions

What has the author Jack H Jung written?

Jack H. Jung has written: 'Genetic syndromes in communication disorders' -- subject(s): Genetic disorders, Genetics, Genetic aspects, Communicative disorders, Inborn Genetic Diseases, Communication Disorders


How many genetic disorders are there?

There are thousands of known genetic disorders, estimated to be around 6,000-8,000. These disorders can range from single-gene mutations, to chromosomal abnormalities, to multifactorial disorders influenced by both genetic and environmental factors. Many genetic disorders are rare, affecting less than 1 in 2,000 individuals.


Are there genetic tests for genetic disorders?

There are many but in cases there are none.


Why can females but not males carriers of sex linked genetic disorders?

Several genetic disorders are caused by genes on the X chromosomes.


Genetic disorders are caused by?

Genetic disorders are caused by abnormalities in an individual's DNA, either through mutations or changes in the genes. These abnormalities can be inherited from parents or can occur spontaneously during a person's lifetime. Genetic disorders can affect various aspects of health and development.


What kind of person studies genetic disorders?

A genetic physician or a geneticist.


Name two genetic disorders?

Two genetic disorders are Turner's syndrome and cystic fibrosis.


How can you lose a baby when you are four months pregnant?

Getting into a collision accident will sometimes do it.Overuse of medications.Overuse of alcohol or drugs.Smoking overuse.Certain genetic disorders.


What are the causes of genetic human disorders?

The causes of genetic disorders areThey can be inherited through Parents;Mutations may occur;A deletion may occur.These are the causes of a genetic disorder.


What is the possible way to cure genetic disorder?

currently there are no treatments for genetic disorders


How many disorders of fat metabolism are related to genetic defects?

Over 30 different disorders of fat metabolism are related to genetic defects.


What clues to the presence of certain genetic disorders can be seen in a karyotypes?

-Extra, missing or damaged chromosomes could show the presence of genetic disorders.