answersLogoWhite

0

TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT

User Avatar

Wiki User

10y ago

What else can I help you with?

Related Questions

How does the sugar in a DNA nucleotide differ from that on an RNA nucleotide?

The sugar in a DNA nucleotide contains one less oxygen atom.


How does the sugar in the DNA in nucleotide differ from that of an RNA Nucleotide?

The sugar in a DNA nucleotide contains one less oxygen atom.


Which nucleotide will bind A nucleotide to parental DNA?

A adenine (A) nucleotide will bind to thymine (T) nucleotide in parental DNA through hydrogen bonding.


Name for DNA subunit?

Nucleotide


How does the sugars in a DNA nucleotide differ from that of an RNA nucleotide?

The sugar in a DNA nucleotide contains one less oxygen atom.


How does the sugar in a DNA nucleotide differ from of an RNA nucleotide?

The sugar in a DNA nucleotide contains one less oxygen atom.


How does the sugar in a DNA nucleotide differ from that in a RNA nucleotide?

The sugar in a DNA nucleotide contains one less oxygen atom.


What is the name of the monomers of DNA?

a DNA nucleotide


Is gcccaaag a molecule of dna?

No, "gcccaaag" is not a molecule of DNA. It is a string of nucleotide bases that could be part of a DNA sequence. DNA molecules are made up of sequences of nucleotide bases like adenine, cytosine, guanine, and thymine.


What is a Dna letter made of?

The Dna letter is a nucleotide base. It is made from a series of nucleotide base substrates.


What are the nucleotides of DNA and rnaa what are there compliments?

DNA nucleotides: adenine nucleotide, guanine nucleotide, cytosine nucleotide, thymine nucleotideRNA nucleotides: adenine nucleotide, guanine nucleotide, cytosine nucleotide, uracil nucleotideBase-pairing in DNA: adenine and thymine, guanine and cytosineBase-pairing in RNA: adenine and uracil, guanine and cytosine


Put these in order by size chromosome nucleus cell DNA and nucleotide?

Nucleotide < DNA < Chromosome < Cell < Nucleus.