0
What else can I help you with?
Continue Learning about Natural Sciences
.37 US quarts equals how many ounces?
That is 11.84 ounces.
How many milliliter are in 15 ounces?
15 ml = 0.51 US fluid ounces.
How many ounces are in a galon?
1 US gallon equals 128 US fluid ounces
How many fluid ounces equals 500 ml?
500 mL is about 16.907 US fluid ounces.
15 cc is how many ounces?
0.507210341 US fluid ounces
Related Questions
How many ounces equals 15 ml?
1.5 US fl oz = 44.36mL
How many oz in 440ml?
440mL equals about 15 (14.9) US fluid ounces.
Are there 15 ounces in one cup?
ANSWER No, there are not. 1 US cup equals 8 US ounces
12 liters equals how many ounces US?
12 litres equals 423.288 ounces.
32 ounces equals how many ml?
32 US fluid ounces equals 946.35mL
3dl equals how many ounces?
10.1442068 US fluid ounces ==
.37 US quarts equals how many ounces?
That is 11.84 ounces.
How many ounces are there in 15 ml?
15 ml = 0.51 US fluid ounces.
How many milliliters are there in 15 ounces?
15 US fluid ounces = 443.6 mL
.25 ounces equals how many teaspoons?
2.5 US fluid ounces = 15 US teaspoons
500cc equals how many ounces?
500 cc = 16.9070114 US fluid ounces
How many fluid ounces equals 850 ml?
About 28.742 US fluid ounces.
Trending Questions
What benefits has society derived from the investment in earthquake research?
What type of volcano is large and dome shaped?
Is bromonaphthalene solvent?
How much Magnesium Carbonate is needed to buffer a solution of twenty litres with pH 2.75 consisting of Cl in water to a pH of 5.4?
Which of the types of cellular activities listed below would not use ATP?
Do bacterial cells have ribosomes?
IS A DECREASE IN THE VOLUME OF MATTER CAUSED BY FORCE?
Which wavelength in the visible light spectrum gets absorbed the quickest in the ocean?
Receptors that detect carbon dioxide levels in the blood are?
How long did it take for mt saint helens to form?
How do you control the bodies ability to make keratin how do you restrain the body from making too much keratin?
What are the stereoisomers in the chemical structure of baycol?
How many fluid ounces in twelve pounds?
3Lb equals grams?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
How do you adjust double hinge?
Can you take a 60Hz blow dryer to Europe and use it in a 50Hz outlet?
One country located South of the equator and East of the Greenwich Meridian?
What happen to a drop of water in the water cycle?
Who was the famous meteorologists William ferrel's parents?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.