answersLogoWhite

0

A diamond is valued by its cut, clarity, carat weight and colour. A local jeweler can show you stones in this category.

User Avatar

Wiki User

15y ago

What else can I help you with?

Related Questions

What is 2 carat diamond?

A two-carat diamond is a gemstone that weighs two carats.


How big is a 12 point diamond?

A 1.00 point diamond is one carat, so a .12 point diamond is a little over 1/10th of a carat.


How big is diamond that has mass of 0.10g?

One carat weight of diamond weighs .20 grammes, so your diamond is about half that weight, or roughly half a carat.


How big is a one carat diamond?

A one carat diamond in the round brilliant shape measures aproximately 6.5mm at the girdle. If the diamond is another cut, measurements will be different.


How big is a diamond .075 carats?

You've given the carat weight of a diamond. 'Big', then, is based on the cut of the stone.


How big is a tenth carat diamond?

Carat is a weight, so its weight is one tenth of a carat or one tenth of .20 grams.


How big is a 1.5mm round diamond?

A 2 mm round diamond weighs about .03 carats, so a 1.5 mm round diamond would be smaller than .03 carats. A .01 carat diamond is about as big as a grain of sand.


What is a 2pt diamond?

A 2 pt diamond is a diamond weighing .02 carats or 2/100ths of a carat.


For a 2 carat diamond what is the mm size?

A two carat round brilliant cut stone will measure about 8.2 mm. A different cut will have a different measurement.


How big is an eighth of a carat diamond?

The diamond weighs .125 carats. Its mm measurements depend on the cut.


How big is a eighth ct diamond?

An eighth of a diamond carat, if it is a round cut, measures about 3.2mm at the girdle.


How big is a diamond 5mm by 3mm?

If the diamond is an ideal emerald cut with these measurements, the diamond may weigh about one quarter of a carat. Otherwise, you have stated the diamond's 'big' size in measurements.

Trending Questions
Is this true or false a population is made up of different communities in an area? What is the root of pertinent? Will gasoline and diesel fuel mix together? How do you cut granite worktops? How many km per hour must you swim if you want to cross a 3-km channel in 2 hours? The small structures in the cell that carry out the cell's activities are known as? How can you use yeast as an indicator to see if theres sugar in a material? What is the medical term meaning disease which results in muscle weakness because of abnormal neuromuscular junction activity? What air in a cool region under neath cloud cover will have other than a regio with no cloud cover? When researchers transform plant cells using a bacterium that causes plant tumors how do researchers prevent plants tumors from forming in the transformed cells? Are all inorganic rocks formed from other rocks? Where would you find the most chemically active metals-toward the left or right side of the periodic table? How many people died from an avalanche? What is a DNA code for a Darkus Hawktor? What is the average velocity when a person traveling on a straight line moves with a uniform velocity v1 for x distance and v2 for next equal distance? What is the role of genetic information in the life of an individual organism? What is the cultural hearth of Islam? How many valence electrons do most atoms need to have a complete outer Shell and be happy? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? What is the abbreviation for laboratory?