answersLogoWhite

0

Examples are: assimilation of foods and respiration.

User Avatar

Wiki User

8y ago

What else can I help you with?

Related Questions

Is rawlings perfect competition?

the struggle between organisms to survive as they attempt to use the same limited resource the struggle between organisms to survive as they attempt to use the same limited resource


What chemistry is focused on the chemistry of organisms?

Biochemistry.


What are organisms that must have oxygen to survive?

Obligate aerobes are organisms that require oxygen to survive, as they use it for their cellular respiration process. These organisms cannot grow or survive in environments with low oxygen levels. Examples include humans, most animals, and many bacteria.


What is inoraganic chemistry?

Chemistry not involving living organisms


What if chemistry never happened?

The humankind cannot survive without chemistry.


How do organisms use cysts?

The cyst enables many organisms to survive in the environment for long periods of time without need for food or water


How does photosynthesis help organisms survive?

photosynthesis helps organisms survive by providing them with oxygen to breathe.


Some organisms use chemosynthesis to survive where do they get the energy for this process?

from chemicals in the ocean


Does a jellyfish have complex chemistry?

All living organisms have a very complex chemistry.


How to survive Physical Chemistry and how did you do it?

Just view it as applied mathematics - dont worry about the chemistry.


How do organism survive?

Organisms survive because they are organisms. Inorganic matter does not survive or live. They get materials from the outside-like gas, food, etc.


Is biochemistry a form of biology?

Biochemistry is a chapter of chemistry; biochemistry is the chemistry of living organisms.

Trending Questions
Where the 5 most abundant metals are located? What does the discovery of a fossil of an ancient fish atop a mountain indicate about Earth's past? How many atoms of oxygen are in five molecules of Penicillin G? What is the importance of the ridosome in the human cell? Why does venus take 243 earth days to spin once? Is a ion is a charged particle because it now had either more or fewer electrons than protons? What areas did cyclone yasi affect? Why do paramecium have cilia? What is the medical term meaning Inflammation of the sclera? What size wire do you need for 20 amp 220 volt electric motor? What is the St Joseph hospital longitude and latitude? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? Lewis structures use dots to depict valence electrons. For the following elements what pattern in the corresponding Lewis dot structures can you identify Lead (Pb) antimony (Sb) sulfur (S) chlorine (C? What geological feature can be created by a divergent boundary? What size wire for 600v to208v 3 phase? How can you remove felt tip pen ink from the front of a photograph? What is heliums gas constant? What is the relationship of the speed of revolution of a planetary object to the position of the planetary object in the solar system? If 1 meter 1 billion years is the scale for a geologic time line approximately how many meters would represent the Paleozoic era? How long does it take to climb Mount Kilimanjaro?