answersLogoWhite

0

Crude oil is currently removed as "primary recovery", "secondary recovery", and tertiary recovery"

In Primary Recovery, all that is required is to sink a well into the reservoir and the pressure of the material above it will force the oil up the well pipe. This is the type of recovery associated with the "gusher well". Even if a well isn't a gusher, it can still be pumped up from the reservoir until the pressure drops too low.

In Secondary Recovery, the pressure in the well is increased by injecting something into the well such as steam, liquid water, natural gas, air or carbon dioxide. The injection occurs at the edge and/or bottom of the reservoir so as to cause the pressure to force the oil ahead of it towards the recovery well bore. Depending on what is injected, the injected material can also lower the viscosity of the oil and aid it in migrating towards the recovery well bore (which would actually be more a tertiary recovery method), but if the main purpose of injection is to boost the pressure, it is still considered secondary recovery.

In Tertiary Recovery, materials are injected into the well mainly to alter the physical properties of the oil, especially the surface tension, in order to get the oil to not stick as much to the matrix of the reservoir and to move more easily through it towards the recovery well. When steam is injected, the heat lowers the viscosity of the oil to make it flow more easily. Surfactant solutions can also be injected to lower the surface tension of the oil. and un-stick it from the reservoir matrix. Carbon dioxide flooding both thins out the oil (lower viscosity) and lowers the surface tension. A newer method is bio-flooding where specially designed microbes are injected with the water. The microbes attack the heavier molecules in the oil and break them down into smaller molecules, which makes the oil less viscous, and incidentally of greater value - gasoline, which is mostly lower weight hydrocarbons, sells for more than tar and asphalt, which are higher weight hydrocarbons.

User Avatar

Wiki User

16y ago

What else can I help you with?

Related Questions

Are plastics from crude oil biodegradable?

No because crude oil does get to the surface so there are bugs that destroy it.


How is crude oil brought to the earths surface?

Crude oil is brought to the Earth's surface through drilling wells into underground oil reservoirs. Once a well is drilled, a combination of pressure from the reservoir and assistance from pumps is used to bring the crude oil to the surface for processing and refining.


How is crude oil excavated?

Crude oil is excavated by drilling wells into underground reservoirs where the oil is trapped. Once a well is drilled, the pressure underground allows the oil to flow up through the well to the surface. The oil is then collected and transported for refining.


Why was crude oil invented?

Crude oil wasn't 'invented' ! It is a natural resource. There is a finite amount of crude oil in the Earth's surface - which will eventually run out... forcing us to use alternatives whether we want to - or not ! !


How is crude oil brought to earths surface?

Crude oil is brought to Earth's surface through the process of drilling. Wells are drilled deep into the earth where crude oil deposits are located. Once the well reaches the oil reservoir, the pressure underground pushes the oil up to the surface, where it can be collected and processed.


Can crude oil be a liquid or a gas?

Crude oil is typically a liquid at room temperature and pressure. However, when brought to the surface, some volatile components may evaporate, turning it into a gas.


How is crude brought to the surface of the earth?

Oil often seeps to the surface, but when it is deep in the earth it is pumped out through an oil well.


What is crude oil and how is it brought to surface of the earth?

Crude oil, also known as petroleum, is a mixture of hydrocarbons. In many cases it is already under pressure because of the weight of the ground on top of it, so if you drill a hole into the pocket of oil, the oil will come up by itself. However, in some cases it has to be pumped out.


How is crude oil brought to the surface of the earth?

Crude oil is brought to the surface of the earth through the process of drilling wells. A drilling rig is used to bore a hole into the earth, and then pumps are used to extract the oil from the reservoir deep underground. The oil is then brought to the surface for further processing and refining.


Where is crude oil and how do you get it?

Crude oil is a type of pure oil that is brought up to our surface by oil wells. Most of the places that we obtain oil is from the Middle East(Iraq, Iran, Saudi Arabia). You can probably buy containers of crude oil on craigslist or on eBay but I don't understand what you would use it for......


How crudeoil is obtained?

Crude oil is obtained through drilling wells into underground reservoirs. The oil is then extracted to the surface using a combination of pressure differentials and pumping systems. Once at the surface, the crude oil is transported via pipelines or tankers to refineries for processing.


Why does crude Oil not dissolve in water?

Crude oil is hydrophobic, which means it repels water and is not soluble in it. This is due to the nonpolar nature of the hydrocarbon molecules in crude oil, which do not interact well with the polar molecules in water. As a result, crude oil will not dissolve in water but will float on its surface.

Trending Questions
Where the 5 most abundant metals are located? What does the discovery of a fossil of an ancient fish atop a mountain indicate about Earth's past? How many atoms of oxygen are in five molecules of Penicillin G? What is the importance of the ridosome in the human cell? Why does venus take 243 earth days to spin once? Is a ion is a charged particle because it now had either more or fewer electrons than protons? What areas did cyclone yasi affect? Why do paramecium have cilia? What is the medical term meaning Inflammation of the sclera? What size wire do you need for 20 amp 220 volt electric motor? What is the St Joseph hospital longitude and latitude? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? Lewis structures use dots to depict valence electrons. For the following elements what pattern in the corresponding Lewis dot structures can you identify Lead (Pb) antimony (Sb) sulfur (S) chlorine (C? What geological feature can be created by a divergent boundary? What size wire for 600v to208v 3 phase? How can you remove felt tip pen ink from the front of a photograph? What is heliums gas constant? What is the relationship of the speed of revolution of a planetary object to the position of the planetary object in the solar system? If 1 meter 1 billion years is the scale for a geologic time line approximately how many meters would represent the Paleozoic era? How long does it take to climb Mount Kilimanjaro?