answersLogoWhite

0

Subjects>Science>Natural Sciences

How fast is 210 knots in kmh?

User Avatar

Anonymous

∙ 14y ago
Updated: 6/29/2024

210 knots = 388.92 km/h

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Continue Learning about Natural Sciences

60 kmh is how many knots?

60 km/h is approximately 32.4 knots.


How fast is 33 kmh in mph?

33 mph = 53.11 km/h


How fast is 357 kmh in miles per hour?

221.83 mph


How fast is 574.8 kmh in mph?

357 mph


How fast is 482 knots?

482 Knots is about 554.78 miles per hour.

Related Questions

How fast is 21 knots in kmh?

To convert knots to kilometers per hour, you can multiply the speed in knots by 1.852. Therefore, 21 knots is approximately 38.9 kilometers per hour (21 x 1.852 = 38.892).


How fast is 10 knots in mph?

1 knot = 1.15 mph 1 knot = 1.852 kmh kmh - 18.52 mph - 11.51


How fast is 308 kmh?

308 km/h is equal to: - 85.555556 m/s - 191.38233 miles/h - 166.3067 knots


60 kmh is how many knots?

60 km/h is approximately 32.4 knots.


What is the ratio between knots and kmh?

it's 1.85 km/h for 1 knots (nautical)


How many mph is 210 knots?

210 knots is 241.6637 miles per hour.


How fast is 50 kmh?

50 kmh = 31.06856 mph


How fast is 1001 kmh?

1001 kmh = 622 mph


How fast is 336 kmh?

336 kmh = 208.8 mph


How fast is 50 kmh in mph?

50 kmh is approximately 32 mph


How fast is 80 to 120 kmh?

about 40 kmh. but if you want to know how fast it is in mph . 80kph is 49.71 mph and 120kph is 74.86mph


How fast is A340?

986 kmh

Trending Questions
What percentage of Italy is hills? What factors affect earthquake death toll? What determines the effect of limiting regent on the mass of a product? What natural resources is found in the grand banks off the coast of Newfoundland? Why do snapdragons need nutrients to grow? Are a Canadian ounce and an American ounce the same volume? What is it called when a compound cannot be solvated? What does g stand for and what occurs in this stage? How many fps are in twelve ft pounds? What forces typically hold non metal atoms together within a molecule? How many 1963 mercury marauders were made with the 427 engine? What animals died during the ice age? Who did Isaac Mary? The first woman to win the nobel prize in literature in 1993? Why does the national hurricane center use a SLOSH model? What Movement of vesicles within the cell depends on what cellular structures? How close was Neptune to the sun in 1989? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? How do you use the land in the Parkland Region? How can Callie's family spends an average of 70 per month on electricity. At the rate what can Callie's family expect to pay of electricity over 1 year?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.