0

Subjects>Science>Natural Sciences

How many g's is the speed of light?

Anonymous

∙ 8y ago

Updated: 11/23/2022

speed of light is constant velocity and does not accelerate so there is no g force

Wiki User

∙ 8y ago

What else can I help you with?

Continue Learning about Natural Sciences

How many mach are in the speed of light?

The speed of light in vacuum is about 874 thousand timesthe speed of sound at sea level.

Is it light speed or the speed of light?

speed of light I think well it sounds right:)

Is it possible to travel at the speed of light in water?

No, it is not possible to travel at the speed of light in water. Light travels at a slower speed in water compared to its speed in a vacuum, which is about 299,792 kilometers per second. The speed of light in water is approximately 225,000 kilometers per second.

How many times is light faster than your running speed?

Running speed is about 3 m/s Light speed is about 300000000 m/s That's 10^8 times faster

Is the speed of sound as speed of light?

The speed of light is much greater than the speed of sound.

Related Questions

What is a footballer with initials GS?

Green Speed

How many Gs does a dual hydronoid have?

1000 gs 1000 gs

How many mach are in the speed of light?

The speed of light in vacuum is about 874 thousand timesthe speed of sound at sea level.

What kind of transmission does the 2010 Lexus GS-350 have?

The 2010 Lexus GS-350 has a 6-speed shiftable automatic.

What kind of transmission does the 2014 Lexus GS-450H have?

The 2014 Lexus GS-450H has a continuously variable-speed automatic.

What kind of transmission does the 2007 Lexus GS-350 have?

The 2007 Lexus GS-350 has a 6-speed shiftable automatic.

What kind of transmission does the 2011 Lexus GS-350 have?

The 2011 Lexus GS-350 has a 6-speed shiftable automatic.

What kind of transmission does the 2010 Lexus GS-450H have?

The 2010 Lexus GS-450H has a continuously variable-speed automatic.

What kind of transmission does the 2014 Lexus GS-350 have?

The 2014 Lexus GS-350 has a 8-speed shiftable automatic.

What kind of transmission does the 2008 Lexus GS-450H have?

The 2008 Lexus GS-450H has a continuously variable-speed automatic.

What kind of transmission does the 2007 Lexus GS-450H have?

The 2007 Lexus GS-450H has a continuously variable-speed automatic.

What kind of transmission does the 2013 Lexus GS-450H have?

The 2013 Lexus GS-450H has a continuously variable-speed automatic.

Trending Questions

What is the name of the organ that acts like a pump? What is two metals are together? What is a transcript protein? Does marmaid exist? What is an example of a good or bad mutation? Does everyone react the same way to alcohol? What is 57 degrees f in c? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT? What is the density of aluminium lm6? Is magnetic force a matter? How does ionic bonding affect the properties of the elements involved? Does a virus need food warth and moisture to grow? What is in inside the leaves? How do you eliminate problem of caustic embrittlement? In what year did Australia begin to change the metric system? How do flowering plants produce male gametes? What colour leaves do edelweiss have? What is the class of wad mineral? Is iron carbonate a soluble salt? How are crystals different in a nanocrystalline than in a metal?

Resources

Top Categories

Product

Company

Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.