0

Subjects>Science>Natural Sciences

How many km in 4 cm?

Anonymous

∙ 10y ago

Updated: 6/29/2024

4cm is 0.00004km

Wiki User

∙ 10y ago

What else can I help you with?

Continue Learning about Natural Sciences

120 km equals how many cm?

120 km is equal to 12,000,000 cm (since 1 km = 100,000 cm).

How many km in 4.3 miles?

4 miles = 6.437376 kilometers The formula to convert miles to km 4 mi* 63360 in 1 mi * 2.54 cm 1 in * 1 km 100000 cm = 6.437376 km

How many km is in 3200 cm?

There are 0.32 km in 3200 cm. You can convert cm to km by dividing the cm value by 100, as there are 100 cm in 1 meter and 1000 meters in 1 km.

8 cm equal how many km?

8 cm = 0.08 m = 0.00008 km (also 80 mm and 80,000,000 nm)

How many km equal to 324 cm?

There are 324,000 millimeters in 324 meters

Related Questions

How many cm are in 4 km?

In 4,000 meters there are 400,000 cm.

How many centimeters in 4 kilomiters?

4 km = 400,000 cm

How many centimeters is 4 kilometers?

By unit of length and distance and conversion ,we can say that 1 km =100000 cm 4 km =400000 cm.

How many centimeters is in 400 km?

1 km = 1000 metres and 1 metre = 100 cm so 1 km = 105 cm So 400 km = 4*107 cm.

How many kilometer would four centimeters equal?

1 cm = 0.000001 km so 4 cm = 0.000004 km

The scale on a map reads 2 cm equals 150 kmhow many kilometerswould be represented by a distance of 4 centimeters?

2 cm = 150 km 4 cm = 300 km

Ratio of 4 cm to 1 km?

To convert the units to the same measurement, we need to convert 1 km to cm. There are 100,000 cm in 1 km (1 km = 100,000 cm). Therefore, the ratio of 4 cm to 1 km is 4:100,000, or simply 4:100,000.

How many centimeter in 10 kilometers?

By unit of length and distance and conversion ,we can say that 1 km =100000 cm 10 km=10000000 cm

Cm represents how many km?

100,000 cm = 1 km. Therefore, there are 5,000,000 cm in 50 km.

The scale of a road map indicates 4 cm is equal to 30 km?

The conversion between km and cm are given .On finding the relation we get as follows . 1 km =1000000 cm . 30 km =3000000 cm. 4 cm : 3000000 cm . Thus , 1 :750000

How many km in a cm?

A kilometer (km) is much larger than a centimeter (cm). There are 100,000 cm in one km.

How many cm in km?

There are 100,000 centimeters (cm) in a kilometer (Km).

Trending Questions

What does not affect the type of igneous rock that forms? What type of elements are bridges exposed to yearly? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? What dangers were there in the Ordovician Period? What contain cells that are greatly swollen and have nuclei that is pushed to the sides of the cell? Write a paragraph explaining how the concerns of physical geography and human geography often overlap? where can I find and buy a rock hammer? How and when did global warming start? What do chloroplasts in a cell look like? Which organelle uses energy from sunlight to make energy-rich food? What are the naturally occurring antibodies? What are effervescent tablets made of? Where is the worlds largest meteropolitan area? How many liters in a pound? What is 154 square feet in meters squared? How many hectoliter in 200 L? Why do potassium dihydrogen phosphate used in carbohydrate metabolism by yeast? What is a shield volcano ? What does monochramatic mean? What is a viral species?

Resources

Top Categories

Product

Company

Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.