How many watts is 60va eqal to?

What is the name of the organ that acts like a pump? What is two metals are together? What is a transcript protein? Does marmaid exist? What is an example of a good or bad mutation? Does everyone react the same way to alcohol? What is 57 degrees f in c? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT? What is the density of aluminium lm6? Is magnetic force a matter? How does ionic bonding affect the properties of the elements involved? Does a virus need food warth and moisture to grow? What is in inside the leaves? How do you eliminate problem of caustic embrittlement? In what year did Australia begin to change the metric system? How do flowering plants produce male gametes? What colour leaves do edelweiss have? What is the class of wad mineral? Is iron carbonate a soluble salt? How are crystals different in a nanocrystalline than in a metal?