answersLogoWhite

0

Subjects>Science>Natural Sciences

How many watts is 60va eqal to?

User Avatar

Anonymous

∙ 11y ago
Updated: 10/16/2024

What else can I help you with?

Continue Learning about Natural Sciences

48 ounces eqal how many pound?

48 ounces = 3 pounds.


How many watts in 0.5 kW?

100 watt


How many watts in a kw?

There are 1,000 watts in a kilowatt (kW).


How many watts are in 2080 megawatts?

It is 2400 million watts.


How many watts is 2000 kw?

2,000 kw is 2,000 kilo watts is 2,000,000 watts

Related Questions

How many 12V 50W bulbs can you run on a 20-60VA transformer?

A 60VA transformer can run only one 50W bulb.


When was EQAL created?

EQAL was created in 2008.


How many GB does 2000mb eqal?

2 gb


How many meters are eqal to 58 kilometers?

58,000 m


How many cm eqal 1m?

100 centimeters equal 1 meter.


How many centimeters does 1 meter eqal?

1 meter = 100 centimeters


How many yards eqal 1 mile?

There are 1760 yards in one mile


How many quarts eqal 1cup?

1/4 quart.


How many meters eqal one kilometer?

There are 1000 metres in a one kilometre.


Two tons is eqal to how many pounds?

2 t(US) = 4000 lb


How many feet eqal to an inch?

There are 12 inches in a foot and .083 feet in a inch


Is 77 eqal to 100100?

No

Trending Questions
What is the name of the organ that acts like a pump? What is two metals are together? What is a transcript protein? Does marmaid exist? What is an example of a good or bad mutation? Does everyone react the same way to alcohol? What is 57 degrees f in c? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT? What is the density of aluminium lm6? Is magnetic force a matter? How does ionic bonding affect the properties of the elements involved? Does a virus need food warth and moisture to grow? What is in inside the leaves? How do you eliminate problem of caustic embrittlement? In what year did Australia begin to change the metric system? How do flowering plants produce male gametes? What colour leaves do edelweiss have? What is the class of wad mineral? Is iron carbonate a soluble salt? How are crystals different in a nanocrystalline than in a metal?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.