answersLogoWhite

0

Helium is colorless

User Avatar

Wiki User

15y ago

What else can I help you with?

Related Questions

Which planet's atmosphere is blue poisonous and composed of methane?

Uranus has a blue-colored, poisonous atmosphere composed primarily of hydrogen, helium, and methane. Its blue appearance is due to methane in the atmosphere absorbing red light, leaving only blue light to scatter.


What is the colour of the planet Jupiter?

Jupiter is predominantly a light beige or tan color. Its atmosphere is composed mostly of hydrogen and helium, which give it its distinctive appearance.


What is a helium filled light?

A helium-filled light refers to a decorative light fixture that uses helium gas to lift and suspend the light source in the air. The light fixture typically consists of a helium balloon or inflatable structure that contains the light source, creating a unique and floating lighting effect.


What is uranuses surfuss made of?

Uranus's upper atmosphere is primarily composed of hydrogen and helium, with traces of methane contributing to its blue-green color. The methane absorbs red light, reflecting blue and green light back into space.


What color is Uranus land?

Uranus does not have any land as it is a gas giant composed mostly of hydrogen and helium. Its atmosphere gives it a blue-green appearance due to the presence of methane gas which absorbs red light and reflects blue and green light.


Why does Neptune appears blue from space?

Neptune's atmosphere is made up of helium, hydrogen and methane. Neptune appears blue because the upper methane atmosphere absorbs the red spectrum from the light and reflects back the blue light spectrum from the sun back into space. Giving the impression that it's a blue planet.


Is helium light or heavy?

Helium is classified as a light element because it has a low atomic mass compared to other elements like oxygen or iron. It is lighter than air, which is why helium-filled balloons float.


Why did planet Neptune called a blue planet?

Neptune's atmosphere is made up of hydrogen, helium and methane. The methane in Neptune's upper atmosphere absorbs the red light from the sun but reflects the blue light from the sun back into space. This is why Neptune appears blue.


What is the composition of the uranus atmosphere?

The atmosphere of Uranus is primarily composed of hydrogen (82.5%) and helium (15.2%), with small amounts of methane (2.3%) and trace amounts of other gases. The blue-green color of Uranus is due to the presence of methane in its atmosphere, which absorbs red light and reflects blue and green light.


Does helium float or sink?

Helium is light and it will float / rise.


What is a light element used for lifting airships?

Hydrogen (explosive), Helium (non-explosive).


What gives uranus it's blue color?

Uranus appears blue due to the presence of methane gas in its atmosphere. Methane absorbs red light from the Sun and reflects blue light, which gives the planet its distinctive hue. Additionally, the planet's atmosphere contains clouds of hydrogen and helium, but the methane is primarily responsible for the vibrant blue color we observe.

Trending Questions
Where the 5 most abundant metals are located? What does the discovery of a fossil of an ancient fish atop a mountain indicate about Earth's past? How many atoms of oxygen are in five molecules of Penicillin G? What is the importance of the ridosome in the human cell? Why does venus take 243 earth days to spin once? Is a ion is a charged particle because it now had either more or fewer electrons than protons? What areas did cyclone yasi affect? Why do paramecium have cilia? What is the medical term meaning Inflammation of the sclera? What size wire do you need for 20 amp 220 volt electric motor? What is the St Joseph hospital longitude and latitude? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? Lewis structures use dots to depict valence electrons. For the following elements what pattern in the corresponding Lewis dot structures can you identify Lead (Pb) antimony (Sb) sulfur (S) chlorine (C? What geological feature can be created by a divergent boundary? What size wire for 600v to208v 3 phase? How can you remove felt tip pen ink from the front of a photograph? What is heliums gas constant? What is the relationship of the speed of revolution of a planetary object to the position of the planetary object in the solar system? If 1 meter 1 billion years is the scale for a geologic time line approximately how many meters would represent the Paleozoic era? How long does it take to climb Mount Kilimanjaro?