Is solid room deodorizer get smaller a physical?

Do the surface of a gas stays level if you tip the container? What are pungent foods? How many centimeters is the right lobe of the liver? Which glows more brighter a 100 w bulb or a 75 w bulb explain? What happens to carbon in rotting trees? What physical concept forms the premise of vsepr theory? Which chemical bond does not involve the sharing or exchange of electrons? What ions make up Fe(CN)2? Is sea salt a type of Epsom salt? How does salt help water boil? Why nonpolar amino acid likely be found in the portion that crosses the lipid bilayer? Volcano greek mythology? Is zinc hydroxide is soluble in ammonium hydroxide? What is smallest part of matter that keeps it's properties? Who was the first to discover the concept of inertia Galileo or Newton? When heating a test tube is NOT required? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? What is a eco-drive watch? Which term describes small ice pellets that form when rain drops fall through cold air and freeze before they hit the ground? What is acute pulmonary edema?