answersLogoWhite

0

Subjects>Science>Natural Sciences

Is solvesso100 polar

User Avatar

Anonymous

∙ 16y ago
Updated: 5/30/2024

No, Solvesso 100 is not polar. It is a hydrocarbon solvent with low polarity.

User Avatar

AnswerBot

∙ 2y ago
Copy

What else can I help you with?

Continue Learning about Natural Sciences

Is TeF6 polar or non polar?

No its not polar


Is C3H6Br2 polar or non polar?

Nonpolar


Is IOF5 polar or non polar?

IOF5 is polar - O has a double bond


Is Hbr non polar or Polar?

Polar!


Is sicl2f2 polar or non polar?

polar

Related Questions

Is TeF6 polar or non polar?

No its not polar


What does non polar and polar mean?

Polar contains polar. Non-polar contains nothing.


Is ClO4 polar or non- polar?

ClO4 is polar.


Is C3H6Br2 polar or non polar?

Nonpolar


Is IF5 polar?

Polar Polar


Is polar or non polar?

polar


Is IOF5 polar or non polar?

IOF5 is polar - O has a double bond


Is Hbr non polar or Polar?

Polar!


Is OH polar or non polar?

Polar


Is SeO3 is polar or non-polar?

polar


Is NaI a polar or non polar?

polar


Is methylene polar or non polar?

polar

Trending Questions
WHICH ONE OF THESE PARTICLES HAVE THE LEAST AMOUNT OF KINETIC ENERGY WATER VAPOR ICE SKIN OR AIR? Are ocean tides inexhaustible? What Does Brine Shrimp Look Like? How do you pronounce kilauea? How does an Amoeba protect itself? Why is saline water preferable but not pure water? Richard Paltauf first described a case of mucormycosis in the middle of which decade? How bad are volcanoes once they start to erupt? How do tractors help plant fields faster? Why are lipids important to cellular evolution? What do you do with Intimacy gel? What is hemopilia? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT? What will happen if sodium hydrogen carbonate reacts with sodium carbonate? Is Transferring graphite from a pencil to paper when writing physical or chemical? How do you calculate CPI (Carbon Preference Index) and OEP (Odd even predominance)? What shape would a molecule with two bond groups an two lone pairs have? What is the planet Mercury's mountains valleys or craters? Why is the Red Granite Wisconsin's State Rock? What are microscopic organisms that cannot make their own food?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.