answersLogoWhite

0

Ecosystems are likely to contain many different herbaceous plants and grasses with scattered small groves of trees and shrubs. The open sunny nature of these systems creates the right conditions for wild lupine, a plant that the Karner blue caterpillar depends on. Wild lupine is the only plant that the caterpillar is known to feed on and therefore critical to survival of the butterfly. Adult Karner blues feed on nectar from a variety of wild flowers like the horsemint, butterfly weed, and bachelors button.

Thanks for reading, Please if I help mark down below that you like it.Bye.

User Avatar

Wiki User

10y ago

What else can I help you with?

Related Questions

How can you save the karner blue butterfly?

what is being done to save the karner blue butterfly


What is the height of a karner blue butterfly?

The karner blue butterfly's height is the size of a nickel.


Is the karner blue butterfly endangered?

Yes the Karner Blue Butterfly happens to be an endangered species!


What is a karner?

A karner is a butterfly species, known as the Karner blue butterfly, that is native to North America. It is a small, endangered butterfly with distinctive silver-blue wings. The Karner blue butterfly is known for its specialized habitat requirements, relying on specific plants like wild lupine for survival.


How much does the karner blue butterfly weigh?

Karner blue butterflies typically weigh 0. 1 ounces or less. The weight of any butterfly depends on how big or small a butterfly is.


Is the karner blue butterfly multicelluar or unicelluar?

multicellular


What is the population of the Karner blue butterfly?

the population is 4


How many babies can a karner blue butterfly have?

12,005,687,587,564


What is the significance of the blue butterfly in Texas?

The blue butterfly in Texas, specifically the Karner blue butterfly, is significant because it is an endangered species that plays a crucial role in the ecosystem. Its presence indicates the health of the environment and serves as a symbol of conservation efforts to protect biodiversity in the region.


What butterflies start with k?

Karner Blue Butterfly is a butterfly. It begins with the letter K.


How do karner blue butterflies responed to preadators?

butterfly preadortars


Is the karner blue butterfly a consumer?

Yes, the Karner blue butterfly is considered a consumer in its ecosystem. As a larva, it feeds on specific host plants, primarily the wild lupine, which provides the necessary nutrients for its development. Adult butterflies feed on nectar from various flowering plants, making them herbivorous consumers that play a role in pollination.

Trending Questions
Is this true or false a population is made up of different communities in an area? What is the root of pertinent? Will gasoline and diesel fuel mix together? How do you cut granite worktops? How many km per hour must you swim if you want to cross a 3-km channel in 2 hours? The small structures in the cell that carry out the cell's activities are known as? How can you use yeast as an indicator to see if theres sugar in a material? What is the medical term meaning disease which results in muscle weakness because of abnormal neuromuscular junction activity? What air in a cool region under neath cloud cover will have other than a regio with no cloud cover? When researchers transform plant cells using a bacterium that causes plant tumors how do researchers prevent plants tumors from forming in the transformed cells? Are all inorganic rocks formed from other rocks? Where would you find the most chemically active metals-toward the left or right side of the periodic table? How many people died from an avalanche? What is a DNA code for a Darkus Hawktor? What is the average velocity when a person traveling on a straight line moves with a uniform velocity v1 for x distance and v2 for next equal distance? What is the role of genetic information in the life of an individual organism? What is the cultural hearth of Islam? How many valence electrons do most atoms need to have a complete outer Shell and be happy? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? What is the abbreviation for laboratory?