0
What else can I help you with?
What is a RNA primer removed by?
A RNA primer in DNA replication is removed by an enzyme called DNA polymerase I in prokaryotes and DNA polymerase δ in eukaryotes. These enzymes have exonuclease activity that can remove RNA primers and replace them with DNA nucleotides.
What rna strand is complementary to the DNA strand gtagtca?
As long as the DNA strand sequence "CTAGGTTAC" is in the 5' to 3' position, the correct RNA sequence would be "CUAGGUUAC". RNA is identical to the coding strand, which is always read 5' to 3'. The only difference is U replaces T.
Where does the RNA polymerase moves down?
RNA polymerase catalyze the synthesis of RNA by copying the DNA. It occurs in the 5' to 3' direction(moves down).
How does the shape or RNA differ from the shape of DNA?
DNA (deoxyribonucleic acid ) has double helix. a phosphate group, and 5 carbon sugar back bone. DNA also has 4 nucleotides that pair, Adenine to Thymine and Guanine to Cytosine. RNA (ribonucleic acid) is a single strand with 5-carbon sugar that has one more oxygen than DNA. The nucleotides in RNA pair Adenine To URACIL, Guanine to Cytosine, and Thymine to Adenine (These pairings happen when the RNA is copying the DNA).
How is RNA nucleotide and DNA nucleotide alike?
we can say they are same consist of sugar& nitrogen base &phosphate group butDNA nucleotide has deoxyribose sugar (mean 5 carbon rings sugar which we took one hydrogen atom from the ring) and RNA nucleotide has ribose sugar(mean 5 carbon sugar).
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
How does RNA polymerase use DNA?
RNA polymerase reads the DNA template and synthesizes a complementary RNA strand by linking together RNA nucleotides according to the base pairing rules. RNA polymerase moves along the DNA strand in the 3' to 5' direction, synthesizing the RNA transcript in the 5' to 3' direction.
How does the process of transcription convert DNA to RNA in a 5' to 3' direction?
During transcription, an enzyme called RNA polymerase reads the DNA template strand in the 3' to 5' direction and synthesizes a complementary RNA strand in the 5' to 3' direction. This process involves matching RNA nucleotides to the DNA template, creating an RNA molecule that is a copy of the original DNA sequence.
Reverse transcription 5' to 3'?
Reverse transcription is the process of synthesizing a DNA molecule from an RNA template. In this process, a reverse transcriptase enzyme catalyzes the formation of DNA nucleotides in the 5' to 3' direction, complementary to the RNA template. This results in the creation of a DNA molecule that is a copy of the original RNA molecule.
What direction does RNA polymerase move along the DNA?
Nucleotides are being added as RNA polymerase moves along the DNA template strand.
Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
What is a RNA primer removed by?
A RNA primer in DNA replication is removed by an enzyme called DNA polymerase I in prokaryotes and DNA polymerase δ in eukaryotes. These enzymes have exonuclease activity that can remove RNA primers and replace them with DNA nucleotides.
In what direction does RNA polymerase read DNA during transcription?
RNA polymerase reads DNA in the 3' to 5' direction during transcription.
Differences of RNA and DNA?
1. RNA have the base uracil whereas DNA have the base thymine. 2. RNA contain ribose sugar residues whereas DNA contain deoxyribose sugar residues. 3. RNA are single-stranded whereas DNA are double-stranded.
RNA polymerase moves in which direction along the DNA?
RNA polymerase moves along the DNA template strand in the 3' to 5' direction, synthesizing a new RNA strand in the 5' to 3' direction.
Is the 5 carbon sugar in DNA nucleotides called a ribose?
It is true, RNA nucleotides contain the five-carbon sugar ribose.
What 5 carbon sugar that makes up RNA and DNA?
In DNA the five-carbon sugar is deoxyribose. In RNA the five-carbon sugar is ribose.
