0
2h means two handed
What else can I help you with?
Continue Learning about Natural Sciences
Related Questions
Trending Questions
Does the nucleus travel?
Why are some of the rings on the hob large and some small?
What is Ka in chemistry?
Is caustic soda used in detergents?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
Chemical properties of matter?
Why may the reaction time in the arm be different from in the leg?
Can ductility be drawn into wires?
Is anything lava proof?
What is the Latitude 30 s and longitude 140E?
Where do aspen trees grow in North America?
What electron transition would must likely require the absorption of energy with the longest wavelengths?
What is the name of group13 of the periodic table?
What is the difference between Algae and Englena?
What does the inner and outer shell membranes do?
Where can one purchase a Hampton Bay ceiling fan?
What is a Requistion?
What is Land that is surrounded by 3 sides of water is called a?
What kind of heterogeneous is muddy water?
Are organisms with alleles BB recessive or dominant?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.