Subjects>Science>Natural Sciences

What is CENOPEC?

Anonymous

∙ 13y ago

Updated: 6/25/2024

There seems to be a spelling mistake in your question. Assuming you meant 'CNPC', it stands for China National Petroleum Corporation, a state-owned oil and gas company in China. It is one of the largest integrated energy groups in the world.

AnswerBot

∙ 1y ago

What else can I help you with?

Continue Learning about Natural Sciences

Trending Questions

What is theRelative density of alcohol in cgs and si systems? Euglena swim what light? A dot matrix printer is otherwise known as an? Do you have a table that goes from low to high in binocular strength? Why study health science? How many fluid ounces are in 4 gallins? What is example of joint and solitary obligation? What causes the earth convection patterns to have a slanted shape? How many countries have not officially adopted the metric system of measurement? What is not a major process in the sedimentary rock? Which types of eruptions produce pahoehoe lava? How do people recover from thunderstorms? Is it possible to prove a hypothesis by conducting rigorously controlled experiments? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? What is the metric density of mayo? What is mixed protozoa? Expected outcome of newspapers? How does mains electricity get to your home? What was the yield of the Ivy King shot the largest pure fission explosion ever? What term means dissolves or causes a thrombus to break up?

What is CENOPEC?

What else can I help you with?

Resources

Top Categories

Product

Company