answersLogoWhite

0

Subjects>Science>Natural Sciences

What is apparteit?

User Avatar

Tonycawood ∙

Lvl 1
∙ 16y ago
Updated: 5/26/2024

"Apparteit" does not appear to be a standard English word. It may be a misspelling or a term from a different language. Could you provide more context or clarify the term so I can assist you better?

User Avatar

AnswerBot

∙ 1y ago
Copy

What else can I help you with?

Continue Learning about Natural Sciences
Related Questions
Trending Questions
Can algae move on its own? What is a sentence using the word herbivore? What temperature will nylon combust? What is the IST time when it is 1230 am in US? What is PM 10? Is taste a measurable property of matter? Why can't you refreeze instant cold packs? What form is matter is clay? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT? What is the molarity of a soloution which contains 22.41 grams of NaCl in 50.0 mL of soloutuon? What are mercury compounds? What is flammable waste? What group belongs in the omnivores? What would the world be like without pasteurization? What precautions can be taken to reduce shrinkage? What is the missing side of the right triangle called? How many atoms are in 1 gram of boron? How does the climate change as you hike from the plains surrounding the mountain to the top of the tallest peak? What is the altitude of Truckee CA? Why does milk make you sleep?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.