answersLogoWhite

0

The goal is to get pictures of mars to find out more about it .NASA is looking at mars for a future home.

User Avatar

Wiki User

13y ago

What else can I help you with?

Related Questions

To which planet was NASA's Curiosity rover sent?

NASA's Curiosity rover was sent to the planet Mars.


What is curiosity rover full name?

The full name of the Curiosity rover is the Mars Science Laboratory Curiosity rover.


What was the name of the robet that NASA sent to mars?

Curiosity


What are the release dates for NASA EDGE - 2007 Curiosity Landing on Mars 6-17?

NASA EDGE - 2007 Curiosity Landing on Mars 6-17 was released on: USA: 9 October 2012


Who created the curiosity mars rover?

The Curiosity Mars rover was designed and built by NASA's Jet Propulsion Laboratory (JPL) in Pasadena, California. The mission was part of NASA's Mars Science Laboratory program and was launched on November 26, 2011, with the goal of exploring the Gale Crater on Mars to assess the planet's habitability. The rover was developed by a team of engineers and scientists, with significant contributions from various universities and organizations.


What is the name of nasa vehicle on mars?

The NASA vehicle on Mars is called the Mars rover, specifically the Perseverance rover.


Where did NASA's Curiosity rover land?

I landed on Mars the Red Planet!


Where did NASA's landrover curiosity landed on mars on aug 2012?

fast mountain


How did curiosity get its name?

The Mars rover Curiosity was named by a sixth-grade student named Clara Ma in a NASA-led contest in 2009. Ma proposed the name "Curiosity" because, as she explained, "curiosity is the passion that drives us through our everyday lives." NASA then selected this name for the rover, which has since been exploring the surface of Mars.


Who invented the Mars rover?

The Mars rover was not invented by a single individual. It is the result of collaborative efforts by scientists, engineers, and researchers from NASA and other organizations. The development of the Mars rovers, such as Spirit, Opportunity, Curiosity, and Perseverance, represents years of work by teams of experts in various fields.


Where did nasa land rover curiosity landed on mars on August 5 6 2012?

fast mountain


Do the militaries had flew to mars?

People have not flown to Mars yet but NASA does have a rover on the planet with the name of "Curiosity."

Trending Questions
Where the 5 most abundant metals are located? What does the discovery of a fossil of an ancient fish atop a mountain indicate about Earth's past? How many atoms of oxygen are in five molecules of Penicillin G? What is the importance of the ridosome in the human cell? Why does venus take 243 earth days to spin once? Is a ion is a charged particle because it now had either more or fewer electrons than protons? What areas did cyclone yasi affect? Why do paramecium have cilia? What is the medical term meaning Inflammation of the sclera? What size wire do you need for 20 amp 220 volt electric motor? What is the St Joseph hospital longitude and latitude? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? Lewis structures use dots to depict valence electrons. For the following elements what pattern in the corresponding Lewis dot structures can you identify Lead (Pb) antimony (Sb) sulfur (S) chlorine (C? What geological feature can be created by a divergent boundary? What size wire for 600v to208v 3 phase? How can you remove felt tip pen ink from the front of a photograph? What is heliums gas constant? What is the relationship of the speed of revolution of a planetary object to the position of the planetary object in the solar system? If 1 meter 1 billion years is the scale for a geologic time line approximately how many meters would represent the Paleozoic era? How long does it take to climb Mount Kilimanjaro?