answersLogoWhite

0

Sedimentary rocks that start with the letter "Y" include yellow sandstone and yule marble. Yellow sandstone is characterized by its yellow hue, often due to iron oxide, and is commonly used in construction and landscaping. Yule marble, primarily found in Colorado, is a high-quality metamorphic rock that originates from limestone but is often categorized with sedimentary rocks due to its sedimentary precursor. These rocks are valued for their aesthetic appeal and durability.

User Avatar

AnswerBot

6mo ago

What else can I help you with?

Related Questions

What is the texture of all inorganic land derived sedimentary rocks?

what is the texture of all inorganic land derived sedimentary rocks


Rocks formed from weathered debris from preexisisting rocks are called?

They are called clastic sedimentary rocks.


What kind of rock does a metamorphic rock start as?

Metamorphic rocks are formed from sedimentary rocks.


What mean by provenance of sedimentary rock?

The word provenance means origin or birth that is start from where the sedimentary rocks are formed.


What has the author Sam Boggs written?

Sam Boggs has written: 'Petrology of sedimentary rocks' -- subject(s): Sedimentary Rocks 'Petrology of sedimentary rocks' -- subject(s): Rocks, Sedimentary, Sedimentary Rocks


Are sedimentary rocks formed from fragments of other rocks chemical sedimentary rocks?

No, sedimentary rocks formed from fragments of other rocks are called clastic sedimentary rocks. Chemical sedimentary rocks form from minerals that are dissolved in water and precipitate out to form rocks like limestone or halite.


Are there any fossils in sedimentary rocks?

Yes all fossils occur in sedimentary rocks or rocks that began as sedimentary rocks.


What rocks start with the letter c?

Rocks that start with the letter "C" include calcite, a common carbonate mineral often found in sedimentary rocks, and conglomerate, a type of sedimentary rock composed of rounded gravel-sized particles. Other examples are chert, a hard, fine-grained sedimentary rock, and coal, an organic sedimentary rock formed from plant material. Each of these rocks has distinct characteristics and formation processes.


What are three types of rocks?

igneous, sedimentary, metamorphic


What type of rocks can contain fossils on them?

Sedimentary rocks. and metamorphic rocks made form sedimentary rocks.


Are sedimentary rocks classified tofoliated sedimentary rocks?

No, sedimentary rocks are not classified as foliated. Foliation is a textural feature found in certain types of metamorphic rocks where minerals are aligned in layers or bands due to pressure and heat. Sedimentary rocks are formed by the accumulation and cementation of sediments and do not exhibit foliation.


How are clastic sedimentary rocks different from organic sedimentary rocks?

they form

Trending Questions
Is this true or false a population is made up of different communities in an area? What is the root of pertinent? Will gasoline and diesel fuel mix together? How do you cut granite worktops? How many km per hour must you swim if you want to cross a 3-km channel in 2 hours? The small structures in the cell that carry out the cell's activities are known as? How can you use yeast as an indicator to see if theres sugar in a material? What is the medical term meaning disease which results in muscle weakness because of abnormal neuromuscular junction activity? What air in a cool region under neath cloud cover will have other than a regio with no cloud cover? When researchers transform plant cells using a bacterium that causes plant tumors how do researchers prevent plants tumors from forming in the transformed cells? Are all inorganic rocks formed from other rocks? Where would you find the most chemically active metals-toward the left or right side of the periodic table? How many people died from an avalanche? What is a DNA code for a Darkus Hawktor? What is the average velocity when a person traveling on a straight line moves with a uniform velocity v1 for x distance and v2 for next equal distance? What is the role of genetic information in the life of an individual organism? What is the cultural hearth of Islam? How many valence electrons do most atoms need to have a complete outer Shell and be happy? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? What is the abbreviation for laboratory?