0
What else can I help you with?
Which pair of nucleotides would pair with the dna segment ttacgc?
The DNA sequence that would pair with the DNA segment TTACGC is AATGCG. The mRNA sequence that would pair with the DNA segment TTACGC is AAUGCG.
What is mRNA transcript for the DNA sequence TTACGC?
The RNA nucleotide sequence transcribed from GCTAATCCG would be: CGAUUAGGC Following Chargaff's Rule, in RNA... C -> G or G -> C A -> U or U -> A and vice versa. In DNA... C -> G or G -> C A -> T or T -> A and vice versa. RNA substitutes Uracil (U) rather than Thymine (T) instead, while DNA uses Thymine (T). If you also want to translate codons, or set of 3 RNA bases (C, G, A, U) into amino acids: CGA -- Arginine (Arg) UUA -- Leucine (Leu) GGC -- Glycine (
Which pair of nucleotides would pair with the dna segment ttacgc?
The DNA sequence that would pair with the DNA segment TTACGC is AATGCG. The mRNA sequence that would pair with the DNA segment TTACGC is AAUGCG.
During replication which sequence of nucleotides would pair with the DNA segment ttacgc?
The DNA segment ttacgc would pair with the complementary RNA sequence aaugcg during replication. In RNA, adenine (A) pairs with uracil (U) instead of thymine (T).
Could DNA be amplified with only one primer?
No because it changes letters so the primer will not be the correct match. They have to be different.For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.
What is mRNA transcript for the DNA sequence TTACGC?
The RNA nucleotide sequence transcribed from GCTAATCCG would be: CGAUUAGGC Following Chargaff's Rule, in RNA... C -> G or G -> C A -> U or U -> A and vice versa. In DNA... C -> G or G -> C A -> T or T -> A and vice versa. RNA substitutes Uracil (U) rather than Thymine (T) instead, while DNA uses Thymine (T). If you also want to translate codons, or set of 3 RNA bases (C, G, A, U) into amino acids: CGA -- Arginine (Arg) UUA -- Leucine (Leu) GGC -- Glycine (
