answersLogoWhite

0

During DNA replication, the sequence of nucleotides that would pair with the DNA segment TTACGC is AATGCG. This pairing occurs due to the complementary base pairing rules, where adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Thus, T pairs with A, T with A, A with T, C with G, G with C, and C with G.

User Avatar

AnswerBot

8mo ago

What else can I help you with?

Related Questions

Which pair of nucleotides would pair with the dna segment ttacgc?

The DNA sequence that would pair with the DNA segment TTACGC is AATGCG. The mRNA sequence that would pair with the DNA segment TTACGC is AAUGCG.


During replication which sequence of nucleotides would pair with the DNA segment ttacgc?

The DNA segment ttacgc would pair with the complementary RNA sequence aaugcg during replication. In RNA, adenine (A) pairs with uracil (U) instead of thymine (T).


What is the mRNA transcript for the DNA sequence TTACGC Check Answer?

To determine the mRNA transcript for the DNA sequence TTACGC, you need to replace each DNA base with its complementary RNA base: adenine (A) pairs with uracil (U), thymine (T) pairs with adenine (A), cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C). Therefore, the mRNA transcript for the DNA sequence TTACGC would be AAUGC.


Could DNA be amplified with only one primer?

No because it changes letters so the primer will not be the correct match. They have to be different.For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.


What is mRNA transcript for the DNA sequence TTACGC?

The RNA nucleotide sequence transcribed from GCTAATCCG would be: CGAUUAGGC Following Chargaff's Rule, in RNA... C -> G or G -> C A -> U or U -> A and vice versa. In DNA... C -> G or G -> C A -> T or T -> A and vice versa. RNA substitutes Uracil (U) rather than Thymine (T) instead, while DNA uses Thymine (T). If you also want to translate codons, or set of 3 RNA bases (C, G, A, U) into amino acids: CGA -- Arginine (Arg) UUA -- Leucine (Leu) GGC -- Glycine (