answersLogoWhite

0

mRNA is synthesized through a process called transcription, where an RNA polymerase enzyme reads a DNA template and assembles ribonucleotides into a single-stranded RNA molecule. The sequence of nucleotides in the mRNA corresponds to the coding sequence of the gene, with adenine pairing with uracil (instead of thymine), and cytosine pairing with guanine. Once synthesized, the mRNA undergoes processing, including the addition of a 5' cap and a poly-A tail, which help stabilize the molecule and facilitate its translation into proteins.

User Avatar

AnswerBot

7mo ago

What else can I help you with?

Continue Learning about Natural Sciences

Which best describes how mRNA is put together?

mRNA is synthesized through a process called transcription, where an RNA polymerase enzyme matches complementary RNA nucleotides to a DNA template strand. This results in the production of a single-stranded mRNA molecule that carries genetic information from the DNA to the ribosomes for protein synthesis.


How are the mRNA bases put into the correct order?

mRNA bases are put into the correct order during a process called transcription. Enzymes called RNA polymerases transcribe the DNA template into mRNA by matching complementary bases (A with U, G with C) to ensure the correct sequence. This process is essential for making a functional mRNA that can be used to produce proteins.


Where does the messenger RNA have to travel to after transcription?

The process wherein messenger RNQ (or mRNA) is given a message is called transcription. In this process, n mRNA molecule is made (or transcribed) using DNA as the template. Essentially, the nucleotide sequence on a gene is read by an enzyme called RNA polymerase which synthesizes the mRNA molecule. Put simply, RNA polymerase scans the length of DNA until a gene is encountered. When the enzyme reaches the correct position, it begins adding complimentary nucleotides to make the mRNA molecule. This way, the entire gene is transcribed and copied on to the mRNA molecule.


What attitude best describes Matthew henson?

he was brave to put the flag even if he was an African American he never ever give up.


What is the mRNA strand for ggctatatcctgcgctatacgcta?

The mRNA strand for the given DNA sequence "ggctatatcctgcgctatacgcta" would be "ccgua.uauggcg..uauacgua" after transcription. This is achieved by replacing each DNA nucleotide with its complementary RNA nucleotide (A-U, T-A, C-G, G-C).

Related Questions

Which best describes how mRNA is put together?

mRNA is synthesized through a process called transcription, where an RNA polymerase enzyme matches complementary RNA nucleotides to a DNA template strand. This results in the production of a single-stranded mRNA molecule that carries genetic information from the DNA to the ribosomes for protein synthesis.


What are the words that best describes a mother?

However your mother looks!Just put it in words!


How are the mRNA bases put into the correct order?

mRNA bases are put into the correct order during a process called transcription. Enzymes called RNA polymerases transcribe the DNA template into mRNA by matching complementary bases (A with U, G with C) to ensure the correct sequence. This process is essential for making a functional mRNA that can be used to produce proteins.


Where amino acids are put together according to the mRNA code?

At the Ribosomes.


How is mRNA put together?

DNA provides instructions for RNA polymerase


What best describes the historical context of the excerpt?

The city has put a light-rail proposal on a ballot for citizens to vote on.


What statements best describes mrs Sommers thoughts or feelings as she put on her new silk stockings?

she was not thinking at all


Which type of RNA carries instructions from DNA in the cell nucleus to the ribosome in the cytoplasm?

Messenger RNA (mRNA) carries the instructions from DNA in the cell nucleus to the ribosome in the cytoplasm. This process is known as transcription and translation, where mRNA serves as the intermediary molecule that carries genetic information for protein synthesis.


Which best describes the theory of communism put forth by Lenin?

D. The revolution would be led by a small group of hard-core dedicated revolutionaries ;)


What is the best statements to describes a storage devices?

A place where you put a sandwich for a long time till it becomes healthy. your welcome, I hope ive helped


Where does the messenger RNA have to travel to after transcription?

The process wherein messenger RNQ (or mRNA) is given a message is called transcription. In this process, n mRNA molecule is made (or transcribed) using DNA as the template. Essentially, the nucleotide sequence on a gene is read by an enzyme called RNA polymerase which synthesizes the mRNA molecule. Put simply, RNA polymerase scans the length of DNA until a gene is encountered. When the enzyme reaches the correct position, it begins adding complimentary nucleotides to make the mRNA molecule. This way, the entire gene is transcribed and copied on to the mRNA molecule.


What makes premature mrna and mature mrna different?

The first (primary) transcript from a protein coding gene is often called a pre-mRNA and contains both introns and exons. Pre-mRNA requires splicing (removal) of introns to produce the final mRNA molecule containing only exons