0
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
Wiki User
∙ 12y ago
It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.
Wiki User
∙ 14y ago
Wiki User
∙ 12y agoCodon: AUG-UUC-GUU-AAC-GAC-CAA-AUU-UAA
Anticodon: UAC-AAG-CAA-UUG-CUG-GUU-UAA-AUU
Add your answer:
Earn +20 pts
What are codon and anticodons?
Codon = 3 amino acid sequence found on mRNA. Anti codon = 3 amino acid sequence found on tRNA.The codons are for the traslation of mRNa to an amino acid sequence by using ribosomes.
Which two structures contain codons and anticodons?
mRNA tRNA
Which molecule determines the sequence of amino acids in a protein?
At the heart of it, DNA is the molecule that codes for the sequence of amino acids. DNA does this somewhat indirectly because its code is transcribed to mRNA, whose codons pair with specific tRNA anticodons, which are associated with a specific amino acid.
What is the relationship between the linear sequence of codons on mRNA and the linear sequence of amino acids in a polypeptide?
The linear sequence of codons on mRNA determines the linear sequence of amino acids in a polypeptide.
Where does the lining up of a codon and an anticodon take place?
A codon is a three-base sequence (three nitrogen bases in a row) on mRNA. It calls for a specific amino acid to be brought to the growing polypeptide.An anticodon is a three-base sequence on tRNA. It matches the codon. That's how the right amino acid is put onto the polypeptide next. The tRNA must fit its anticodon onto the mRNA codon like a jigsaw puzzle piece. Each tRNA can only bring one kind of amino acid.
Trna has codons or anticodons?
anti-codons for sure!
Are codons and anticodons found in DNA?
I think codons are found on dna. Anticodons are found only on trna.
Where do codons and anticodons pair?
In the ribosome
What are codon and anticodons?
Codon = 3 amino acid sequence found on mRNA. Anti codon = 3 amino acid sequence found on tRNA.The codons are for the traslation of mRNa to an amino acid sequence by using ribosomes.
How many anticodons are there?
Well, think about it. There are 64 codons so there must be 64 anticodons
What part do codons and anticodons play in translation?
tRNAanti-codonsact as the interpreters of the mRNA codon sequence
Which two structures contain codons and anticodons?
mRNA tRNA
Where are codons and anticpdpns found?
Codons are found on messenger RNA, while anticodons are found on transfer RNA
What type of RNA has neither anticodons or codons?
Ribosomal RNA (rRNA)
Are codons found in mRNA or tRNA?
mRNA is made up of anticodons
What is the purpose of the P site in ribosomes?
Anticodons are attached to the codons on the mRNA.
The three bases on the tRNA molecule that are complentary to one of the mRNA codons are called?
Anticodons.
