The complementary base of A is T, and the complementary base of G is C. So if there is an T the complementary would be A, and if there is a C the complementary would be a G and so on. Therefore the complementary strand would be: G A A T C C G A A T G G T.
UAG GCA AUA CAU GGU btw, I got 100% on the ce.byu.edu speedback
The complementary DNA strand would be TAC CAG GAC GCG.
gcctaatccgtatggccggtatcatca
cggattaggcataccggccatagtagt
these are the complement strands of eachother.
aug uac cgc auc cau auu uag
gaatccgaatggt
CTAGGTACTCAATG
Diploid cells
The DNA template strand is used to create mRNA.
what is a practical or clinical use of knowing the base sequence of a gene
Must use the forward and reverse primers to bind to complementary sequence at the 3' end of the template strand - each NEW strand is built in 5' to 3' direction. They flank the targeted gene region - must attach one to each strand of the target DNA.
A gene consists of a specific sequence of bases; variations in that sequence make for a different gene.
A gene is a strand of DNA that codes for a specific trait
A linear stretch of DNA that specifies the sequence of amino acids in a polypeptide is called a gene. The primary function of DNA ligase is to seal new short stretches of nucleotides into one continuous strand.
The first stage of gene expression is known as transcription. This is the process by which RNA Polymerase, along with other transcription factors, reads and transcribes the DNA sequence into a complementary RNA strand.
A mutation is a permenent in DNA sequence of a gene,mutation in a gene's DNA sequence can alterthe aminoacid sequence of the protein encodedby the gene.
Diploid cells
The DNA template strand is used to create mRNA.
gene sequence
what is a practical or clinical use of knowing the base sequence of a gene
A Chromosome is a threadlike linear strand of DNA and associated proteins in the nucleus of eukaryotic cells that carries the genes and functions in the transmission of hereditary information. It is a circular strand of DNA in bacteria that contains the hereditary information necessary for cell life.As appose to a Gene A hereditary unit consisting of a sequence of DNA that occupies a specific location on a chromosome and determines a particular characteristic in an organism. Genes undergo mutation when their DNA sequence changes.
A Chromosome is a threadlike linear strand of DNA and associated proteins in the nucleus of eukaryotic cells that carries the genes and functions in the transmission of hereditary information. It is a circular strand of DNA in bacteria that contains the hereditary information necessary for cell life.As appose to a Gene A hereditary unit consisting of a sequence of DNA that occupies a specific location on a chromosome and determines a particular characteristic in an organism. Genes undergo mutation when their DNA sequence changes.
Must use the forward and reverse primers to bind to complementary sequence at the 3' end of the template strand - each NEW strand is built in 5' to 3' direction. They flank the targeted gene region - must attach one to each strand of the target DNA.
According to me,when this strand is transcribed the mRNA formed is not coding for any mino acid that is why this portion of gene is removed from DNA.