0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is 4 T on a C's U?
4 Teats on a Cow's Udder
What is 4 T on a C U?
4 Teats on a Cow's Udder
How do you spell sub aquatic?
s u b a q u a t i c
Who of famous people his birthday is april21?
Go to FamousRoots.com to check out other famous birthdays. Here is April 29th.Charlotte BronteW r i t e r [ d. 1855 ]Anthony QuinnA c t o rElizabeth Alexandra Mary WindsorR o y a l t y Queen Elizabeth IICharles GrodinA c t o rIggy PopM u s i c a l A r t i s tTony DanzaA c t o rAndie MacdowellA c t r e s sRobert SmithM u s i c a l A r t i s tMichael TimminsM u s i c a l A r t i s t
Derive using inference given conclusion if g then c premise one if g or h then s and t premise two if t or u then c and d?
g => (g or h) => (s and t) => t => (t or u) => (c and d) => c.We are given premises:# (g or h) -> (s and t) # (t or u) -> (c and d) We would like to derive g -> c.If we assume g (the antecedent in the conclusion) we have the following derivation: # g (assumption) # g or h(weakening) # s and t (premise 1 (modus ponens)) # t(weakening) # t or u (weakening) # c and d (premise 2 (modus ponens)) # c (weakening)So, assuming g we can derive c, i.e. g -> c
What is the word i i o o u c n n s t t t?
Constitution.
What state is spelled with 13 letters?
M-A-S-S-A-C-H-U-S-E-T-T-S Massachusetts !
What is the amino acid sequence for t a c a c c t t g g c g a c g a c t?
Before we look at the complimentary mRNA sequence of the given DNA sequence, let us remember that RNA contains uracil (U) in place of Thiamine (T) The querry sequence is: t-a-c-c-t-c-g-c-a-a-c-t So the mRNA sequence would be: A U G G A G C G U U G A
How many times can chu smash buns?
C P C T C a a a a h u c n s i s o t c e e k e n
How do you spell racist slur?
r a c i s t s l u r
How do you spell the sound of static?
"t-h-e s-o-u-n-d o-f s-t-a-t-i-c"
What is the mRNA strand for ggctatatcctgcgctatacgcta?
GGAUGCACU C binds to G and A binds to U.
