0
GGAUGCACU
C binds to G and A binds to U.
Wiki User
∙ 14y ago
Add your answer:
Earn +20 pts
How is dna made into mRNA?
DNA is not made into mRNA, it is transcribed by mRNA. The DNA molecule is split into two strands by the enzyme helicase. One strand is the sense strand and the other is the anti-sense strand. Then mRNA nucleotides pair with their complimentary DNA bases on the antisense strand. The enzyme RNA polymerase causes the mRNA nucleotides to bond with one another, forming a strand of mRNA.
Which strand of DNA transcribes into mRNA?
The strand running in the 3'-5' end will be the one that RNA copies, as this is the direction of transcription
Is a strand of mRNA short?
That depends on the type of protein it needs to make. Bigger the polypeptide, longer the mRNA.
If DNA is described as a double helix how should mRNA be described-?
mRNA is like a single strand instead of a double strand. If DNA is like a twisted ladder, then mRNA is like a single half of that ladder, with only half the bases.
What process and produces mRNA?
The process that produces mRNA is known as transcription. In this process a single DNA strand is used to make a copy of mRNA.
How is dna made into mRNA?
DNA is not made into mRNA, it is transcribed by mRNA. The DNA molecule is split into two strands by the enzyme helicase. One strand is the sense strand and the other is the anti-sense strand. Then mRNA nucleotides pair with their complimentary DNA bases on the antisense strand. The enzyme RNA polymerase causes the mRNA nucleotides to bond with one another, forming a strand of mRNA.
How many strand of mRNA are transcribed from the two unzipped strands of DNA?
One mRNA strand is made.
How many strands does mRNA have?
a MRNA strand is a strand made up of messenger ribosenucleicacids
A protein contains 131 amino acids How many bases will there be on the mRNA strand corresponding to these amino acids and how do you know?
131*3=393 bases might be there on mRNA strand 3 codons of mRNA strand deduce an aminoacid of a protein, so here, mRNA strand bases are being asked.
What is formed when reverse transcriptase is used on of strand of mrna?
A strand of DNA
What is formed when reverse transcriptase is used on strand of mrna?
A strand of DNA
Which strand of mrna would be made during transcription using the dna strand gat ccg?
Ucg cga GAC UAU
How is DNA copied and made into a mRNA?
There is no such process. DNA cannot come from RNA unless it contains reverse transcriptase. However, there is a process that makes mRNA from a DNA strand. This process is called transcription.
What is formed when reverse transcriptase is used on a strand of mRNA?
A strand of DNA
What is the mRNA of the DNA strand aatcgtttaaatatattgggcccgggcccggggcgcg?
UUAGCAAAUUUAUAUAACCCGGGCCCGGGCCCCGCGC
What is the complementary mrna strand for cca?
it is ggu
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
