That depends on the type of protein it needs to make. Bigger the polypeptide, longer the mRNA.
DNA is not made into mRNA, it is transcribed by mRNA. The DNA molecule is split into two strands by the enzyme helicase. One strand is the sense strand and the other is the anti-sense strand. Then mRNA nucleotides pair with their complimentary DNA bases on the antisense strand. The enzyme RNA polymerase causes the mRNA nucleotides to bond with one another, forming a strand of mRNA.
The strand running in the 3'-5' end will be the one that RNA copies, as this is the direction of transcription
mRNA is like a single strand instead of a double strand. If DNA is like a twisted ladder, then mRNA is like a single half of that ladder, with only half the bases.
The process that produces mRNA is known as transcription. In this process a single DNA strand is used to make a copy of mRNA.
comp : tacctgtttgagttgagt mrna : uaccuguuugaguugagu For comp: just go opposite, c is opposite of g, and a is opposite of t For Mrna: do the same except when you would have a t(thymine) make it a u(uracil) since mrna doesnt have any thymine in it.
DNA is not made into mRNA, it is transcribed by mRNA. The DNA molecule is split into two strands by the enzyme helicase. One strand is the sense strand and the other is the anti-sense strand. Then mRNA nucleotides pair with their complimentary DNA bases on the antisense strand. The enzyme RNA polymerase causes the mRNA nucleotides to bond with one another, forming a strand of mRNA.
One mRNA strand is made.
a MRNA strand is a strand made up of messenger ribosenucleicacids
131*3=393 bases might be there on mRNA strand 3 codons of mRNA strand deduce an aminoacid of a protein, so here, mRNA strand bases are being asked.
A strand of DNA
A strand of DNA
Ucg cga GAC UAU
There is no such process. DNA cannot come from RNA unless it contains reverse transcriptase. However, there is a process that makes mRNA from a DNA strand. This process is called transcription.
A strand of DNA
UUAGCAAAUUUAUAUAACCCGGGCCCGGGCCCCGCGC
it is ggu
The complimentary strand of MRNA would be AAUUCCGG.