0
How do you write the complementary strand and mRNA strand for atggacaaactcaactca?
Wiki User
∙ 13y ago
comp : tacctgtttgagttgagt
mrna : uaccuguuugaguugagu
For comp: just go opposite, c is opposite of g, and a is opposite of t
For Mrna: do the same except when you would have a t(thymine) make it a u(uracil) since mrna doesnt have any thymine in it.
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
Complementary base pairing links?
Adenine pairs with thymine (A-T); guanine pairs with cytosine (G-C) The mRNA transcribed from the antisense DNA strand is not identical to that DNA strand; it is complementary. -the mRNA has the 'partners' of the bases on the DNA template (remembering that RNA uses U instead of T) -it IS identical to the sense strand; therefore, it carries the code for the protein. -if the DNA says ACC, the mRNA says UGG.
What is Strand A flu?
An RNA virus whose genome is complementary to RNA and that carries mRNA polymerases necessary for the synthesis of a new virus.
What is the mrna produced in a t t c g a c c t a c g?
In RNA - A binds to U, C binds to G. Therefore the complementary mRNA strand of ATTCGACCTACG would be UAAGCUGGAUGC.
How is dna made into mRNA?
DNA is not made into mRNA, it is transcribed by mRNA. The DNA molecule is split into two strands by the enzyme helicase. One strand is the sense strand and the other is the anti-sense strand. Then mRNA nucleotides pair with their complimentary DNA bases on the antisense strand. The enzyme RNA polymerase causes the mRNA nucleotides to bond with one another, forming a strand of mRNA.
What is important about the DNA template strand?
The template and non-template strands of DNA are complementary.This means that if a T (thymine)occurs on one strand, there must be an A (adenine) in that position on the other strand, and that C (cytosine) is always opposite G (guanine), following the rules of complementary base pairing.There are other names for the two strands, but Googling them shows there is a lot of confusion out there! The terms "template strand" and "non-template stand" seem to be the only ones that everyone uses consistently. The template strand is the strand along which messenger RNA is synthesized, and has, of course, a base sequence complementary to that of the RNA.The term "gene" is often applied to the non-template strand, the argument being that the non-template DNA strand and the mRNA have the same base sequence (except that where DNA has T, RNA has U, uracil).In transcription, RNAP uses template strand to make a copy of mRNA. Complementary to template strand is the coding strand, which sequence is identical to mRNA sequence except for the substitution of U for T. Although the coding strand is not used as a template for common transcription events, it is called coding because its sequence is used as a copy in mRNA sequence. For the case of "sense", terminologically template strand is called antisense, and coding strand is called the sense strand.Template/non-coding/antisenseNon-template/coding/senseMany people confuse complementary sequences with palindromic sequence which you can find in restriction system recognition sequences. Although the template strand yields a sense (functional) sequence in mRNA and thus a properly-folded protein, the complementary strand of it, non-template strand upon being transcribed yields a totally different and non-functional protein. However in terms of transcription of palindrome, both strands yield the same mRNA sequence, thus the same protein.Coding strand of a particular gene can be on one of either two strands of DNA, and thus this applies to the opposite strand of the said strand for the non-coding strand. The direction of transcription on a double-stranded DNA depends on whether the upper or lower strand is being transcribed. Therefore on a linearised genome, transcription occurs to the left for certain genes and to the right for the remaining genes.
How do you know what to write for each of the new mrna codes?
mRNA is the complementary of the DNA strand that it attatches to, and replace T with G
What is the complementary mrna strand for cca?
it is ggu
What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?
The template strand is used to make a complementary copy. This is a type of DNA strand.
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The strand is called the parental strand. the gene being copied would depend on which protein is needed.
Is thera a Drawing of a mRNA srand that is complementary to the DNA strand aattgc?
No.
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What strand of mRNA would be produced from the strand of DNA shown below?
The DNA strand CAT-TAG would produce a complementary mRNA strand of GUA-AUC.
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
Complementary to an mRNA codon?
it depends on the codon spcified. The tRNA will have the complementary strand along with an amino acid, for which is specified by the mRNA. if the mRNA codon was "CGA" the tRNA codon would have an amino acid and the complementary codon of "GCU"
Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?
Yes. The strand of RNA is messenger RNA, mRNA.
What would the DNA sequence have been for the following mrna strand cuc-aag-ugc-uuc?
mRNA forms a complementary sequence to the DNA it is transcribed from. Therefore, the DNA strand would be the complement (opposite base pair) from what is present in the mRNA. Also, remember that RNA uses uracil (U) in place of thymine (T). For the mRNA strand CUC-AAG-UGC-UUC, the complementary DNA strand would be GAG-TTC-ACG-AAG.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
