0
An original DNA strand has the following base sequence ACGTAAGCT What base sequence would be produced through transcription?
Wiki User
∙ 7y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What is a major difference between DNA replication and transcription?
RNA molecules produced by transcription are much shorter in length than DNA molecules produced by replication.
What is directly produced by the process of transcription?
RNA Molecules
Messenger RNA is produced during the process of?
Transcription
What is produced during transcription?
In protein synthesis, transcription is when the mRNA is made using a DNA template. Transcription includes the manufacturing, splicing, and the adding of caps and tails of the mRNA. This all occurs in the nucleus of the cell. ---messenger RNA is produced.
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What is a major difference between DNA replication and transcription?
RNA molecules produced by transcription are much shorter in length than DNA molecules produced by replication.
What happen during transcription?
mRNA is produced from the DNA.
What is directly produced by the process of transcription?
RNA Molecules
Messenger RNA is produced during the process of?
Transcription
What is produced during transcription?
In protein synthesis, transcription is when the mRNA is made using a DNA template. Transcription includes the manufacturing, splicing, and the adding of caps and tails of the mRNA. This all occurs in the nucleus of the cell. ---messenger RNA is produced.
What is a major difference between DNA replication DNA transcription?
RNA molecules produced by transcription are much shorter in length than DNA molecules produced by replication.
Where is new mRNA produced?
mRNA is produced inside the nucleus of the cell after transcription has occurred.
What molecule is produced by RNA polymerase during transcription.?
mRNA
What is a effect on an error during transcription?
A possible effect on an error during transcription is that a nonfunctioning protein will be produced. The protein would be made of the wrong amino acids chain will be produced (and wrong shape). The wrong protein will be produced. the wrong amino acid chain will be produced
What is possible effect of an error transcription?
A non-functioning protein will be produced.
What molecule is produced by the RNA polymerase during transcription?
RNA polymearse
