answersLogoWhite

0

Are the crows still here today?

User Avatar

Anonymous

∙ 14y ago
Updated: 8/17/2019

yup dey still exist they live in Montana or Missouri

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Related Questions

When was Still Life with Crows created?

Still Life with Crows was created in 2003.


What is the ISBN of Still Life with Crows?

The ISBN of Still Life with Crows is 0-446-53142-1.


How many pages does Still Life with Crows have?

"Still Life with Crows" by Douglas Preston and Lincoln Child has approximately 448 pages in paperback format.


What is a sentence for crows?

There are crows nesting in my garden.Crows are very intelligent wild birds.


Is there assassins still here today?

Yes.


Is oligarchy still here today?

Oligarchy can be used today in china


Inuits if they where still here today what would they look like?

Inuit still are here today and they look a lot like Asians because that's where they came from.


Is Phoenicia still here today?

No, it is Lebanon and Syria.


IS the London Eye still there?

yes the london eye is still here today well in london buy tickets today


Are the Cherokees still here today?

Yes they are still here my half sisters are Cherokee most of the Cherokees are in Oklahoma where i live.


Is Bill Cosby still here today?

Bill Cosby is not here, as far as I can tell...


Are octupus still alive now here?

If by "here" you mean in the ocean, then yes octopus are still alive here. Octopus are plentiful in today's oceans.

Trending Questions
Where should a seven branched menorah be placed? Misprint you have a quarter and on the back it says Northern Mariana islands is that a misprint? Remove the front door speaker landcruiser? How high did sputnik go up? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? Which describes an aspect of total war as it was practiced during the Civil War? What is the Irish Gaelic for 'fire earth metal water and wood'? How can cactus be more useful than a rose? What do governments do to stabilize the economy? What are the harmul affects oxycodeine? What is 10 percent of 650000? Can you use frozen vegetables that have thawed? How do you get a Disney copyright permission? How do you round 735901 to nearest hundred thousand? What is the 2013 murder capital? What maths do you need to know to become an electrician? Calculate heat of fusion? Why some of the word use ed at the end of a word? Can cocci bacteria be found in animals? Timely filing limit for blue cross in Texas?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.