0
What else can I help you with?
Related Questions
Can someone give a registration code for spore?
No.
Can someone give you a good account on dragonfable?
If someone is willing to give their account away, then yes, someone can give you their account.
How old do you have to be to create a spore account?
You need to be 13 to make a spore account
How do you create a spore account?
You have to buy the actual game to make an account on spore. I learned that the hard way.
Can someone give me their member account on fantage if they don't want it?
Yes, someone could give you their account on Fantage.
You lost your activation code for spore creepy and cute could someone give you one for free?
NO
How do you give a fantage account away?
Give it to a friend or someone
Can someone give me a free drago art account?
Make an account
Can someone give a rune scape account?
NO
Is it safe to give someone your account number?
No, it is not safe to give someone your account number as it can lead to unauthorized access to your financial information and potential fraud.
Can someone give you a free dragonfable account?
Yes, but not me.
Can someone give me a used hogwarts live account?
No
Trending Questions
How do you Replace ignition coils in Ford Expedition?
What materials are needed to wallpaper two rooms in my home?
When selling girl scout cookies do people pay you straight away?
Fidelity Investments vs. Fidelity National Financial?
what did congress create election day in hope of ?
Can verbal abuse be used in court against parents?
What is the song played in tropic thunder after the guys finished the ambush scene?
How do you reset oil life on my 2009 Chevy Malibu?
Why do ponies stick their bum up and legs stretched out?
Video how to replace fuelpump for 2002 Pontiac sunfire?
How do you do web check in online for Indigo Flights?
What is a devise that converts electrical energy into mechanical energy?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What continent is 20 south and 20 east?
Is matchstick is a conductor?
Can a 99 civic front end fit on a 97 civic?
What channel is lifetime on if you haveRodgers?
How to spell numbers 1-31?
How do you remove a 1.5 inch by 2 feet vertical dent from a steel garage door?
Disadvantages of oil consumption?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.