answersLogoWhite

0

Can you see a picture of trace Cyrus?

User Avatar

Anonymous

∙ 15y ago
Updated: 8/17/2019

If you mean on Google, yes you can. Just search 'Trace Cyrus'. He is also famous from the band Metro Station, and if you look on the family Cyrus' old family pictures, he's the blond surfer boy (:

User Avatar

Wiki User

∙ 15y ago
Copy

What else can I help you with?

Related Questions

Can you have a picture of trace Cyrus?

just search for images on yahoo, then search trace Cyrus


What does Miley Cyrus's brother look like?

See Related Links for a picture of Miley, her father, and her brother Trace.


Is there a picture of her brother that is in metrostation?

Yes just go to YouTube and type in Trace Cyrus and his picture will come up!!!


What is miley brother name?

trace that is Miley Cyrus


Is Trace Cyrus a girl?

Trace Cyrus is male


What do Trace and Branson Cyrus look like?

no trace Cyrus is a goth and branson Cyrus is cute CORRECTION: Trace Cyrus is NOT goth. I don't know what Trace Cyrus considers himself to be, but it isn't GOTH.


What is trace Cyrus really name?

Trace Dempsey Cyrus.


Who does trace Cyrus date?

It is not confirmed who Trace Cyrus dates.


What is the age of trace Cyrus?

trace Cyrus is coming 21


Is trace Cyrus 21?

Trace Cyrus is not 21, he is 20.


What is Trace Cyrus whole name?

Trace Dempsey Cyrus.


Who are trace Cyrus's step sisters?

Trace Cyrus' Stepsisters are: Noah Cyrus and Miley Cyrus. His real sister is Brandi Cyrus.

Trending Questions
Which item decreases as heat is applied? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg? Does marriott have any properties in Bermuda? Can a heat exchanger be replaced on a laars lite 2 LD400P? How do you open a vanguard brief case whose combination you forgot? What does une carte de bus mean in English? What happens when melting gold and silver together? Is there a such thing the number a? How many nickels equal 45cents? What Pokemon can learn cut in emerald? When is kvpy 2010 exam? What is 45 degrees Fahrenheit in Celsius? How do you rent space in the food court at menlo park mall? What are the characteristics of livings things? Why is Macbeth glad banquo is not returning to the palace until dark? Can a daycare sue you for not paying a two weeks notice? Which food do bacteria hate? What was the name of the first animal that was launched into space and what was the date? What language is tausend kronen? How can 50 centimeters be expressed as millimeters?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.