answersLogoWhite

0

DNA strand have what 4 bases?

User Avatar

Anonymous

14y ago
Updated: 8/17/2019

Adenine

Thymine

Cytosine

Guanine

Adenine pairs up with Thymine

Cytosine pairs up with Guanine

User Avatar

Wiki User

14y ago

What else can I help you with?

Related Questions

Which enzyme is responsible for adding complementary DNA bases to an exposed DNA strand?

The enzyme responsible for adding complementary DNA bases to an exposed DNA strand is DNA polymerase.


During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?

gaucgaucacucaggacuaug


What is the particular side-by-side arrangement of bases along the DNA strand?

To what particular DNA strand are you referring?


What is the name of the enzyme that match the DNA bases?

DNA polymerase matches the bases on the parent strand.


What are the bases on the complimentary strand of bases for strand with the bases AAGCCA?

The complementary strand for bases AAGCCA would be TTCGGT. In DNA, adenine pairs with thymine and guanine pairs with cytosine.


What is the name of the enzyme that places the corresponding nitrogen bases on the new strand of DNA?

The enzyme responsible for placing the corresponding nitrogen bases on the new strand of DNA is called DNA polymerase. DNA polymerase is essential for DNA replication as it helps add nucleotides to the growing DNA strand according to the sequence of the template strand.


What stand of DNA has the same bases agtaac?

The DNA strand that has the same bases as "AGTAAC" would be its complementary strand, which is "TCATTG." In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C), so each base on one strand is matched by its complementary base on the opposite strand.


What is the order of bases in the second strand of the DNA molecule?

The order of bases in the second strand of a DNA molecule is complementary to the first strand, following the base pairing rules (A with T, C with G). So, if the first strand has the sequence ATCG, the second strand would have the sequence TAGC.


What determines the nitrogen base sequence of a DNA in a new strand of DNA?

Since A pairs with T, and G pairs with C, then the sequence of bases in the strand of DNA being copied determines the sequence of bases in the newly copied strand. The bases are complementary (A gives T and G gives C when copied).


When DNA replicates the new strand is what to the original strand?

The new strand is complementary to the original strand. This means that the bases on the new strand pair with the bases on the original strand according to the rules of base pairing (A with T and G with C).


What would be the complimentary bases for a.t.c.g.c.a.t.t. for a dna strand?

A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.


Which enzyme assembles the complementary nucleotide bases during replication?

DNA polymerase is responsible for assembling complementary nucleotide bases during DNA replication. It adds nucleotides to the growing DNA strand using the existing strand as a template.