answersLogoWhite

0

Food in World War 2

User Avatar

Anonymous

∙ 15y ago
Updated: 4/25/2021

Food was rationed because the Germans bombed are supply boats so we didn't have enough food. To share the food equally food was rationed. Not all food were but foreign food. Clothes were also rationed.

User Avatar

Wiki User

∙ 15y ago
Copy

What else can I help you with?

Related Questions

How did civilians brought war effort in world war 2?

food


What was food like in world war 2?

It was edible.


What would they have for lunch in World War 2?

food


What was the nickname givin to food rationing in World War 2?

age of no food


Why was food rationed in Britain during World War 2?

cos we had no food


Did they save food for the World War 2?

No because it came unexpected that world war two came


What ways are there of preserving food in world war 2?

It was mostly caned food and dehydrated food.


What year did food processing begin?

The World War 2


Where did Britain get food from world war 2?

yes it is proin


What food was eaten in Finland during the world war 2?

but


What food did pigs eat in World War 2?

anything!


What food did the Japanese eat in World War 2?

Rice

Trending Questions
Where is the Ferrari car manufactured? Why are my lifters tapping after flood water was drained from the engine and the oil has been changed? What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT? Did Alexander Fleming do bad? What is the meaning of game over? What is 390.98 rounded to the nearest square meter? What are intercalated disks? Why do you think graphs are a useful way to display information? Who is lyasan utyasheva? What objects in outer space can hit earth and cause major damage to earth? Why do Tamils wear dhotis? How much is yu gi oh card number 39 utopia worth? How much should you feed your 30 lb dog? How much does an aircooled vw engine weigh? What are organisation management and technology dimensions of information systems? How many miles from Houston TX to Franklin TN? What is the correct spelling for Best friend? What is weight of pressure treated 12 x 12 piling? Why are my tomato plant leaves drooping and curling? What is the process that produces starch from the leaves?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.