0
The major landowners who became the ruling class in ancient Rome were the Patricians.
What else can I help you with?
Related Questions
How did romes military problems weaken the empire?
Romes soilders became less loyal and disiplined
What city became Romes chief rival?
i wish i had the answer :(
Who became romes first emperor in 27 BC?
Octavian/Augustus became Rome's first emperor.
What is the birth name of Charles Romes?
Charles Romes's birth name is Charles Michael Romes.
How tall is Charles Romes?
Charles Romes is 6' 1".
Who was Romes first permanent Dictator?
Julius Caesar became the first Roman dictator who was appointed for life (dictator perpetuus, dictator in perpetuity).
What helped romes trade?
Italy
Which of Romes internal problems hurt the empire most?
which of romes internal problems hurt the empire the most
When was Charles Romes born?
Charles Romes was born on December 16, 1954, in Verdun, Meuse, France.
How was Romes democracy?
jmjmjmmmj
What is romes achievements?
the answer is the colosseum
Who is Romes mayor?
Walter Veltroni
Trending Questions
List three biological activities that require energy?
What type of candy starts with a d?
What is meaning of tian shi?
International rating of habib metropolitan bank?
How long does it take to decompose a foam cup?
What can a protagonist approach to conflict show about the cultural values behind a work of literature?
What is the mRNA strand for ggctatatcctgcgctatacgcta?
Where was the best place to build motte and bailey castles?
Is Pokemon Rumble for wiiware software or is it on a disk?
How fast can the ferrari 612 GTO go?
What 2 sides fought in world war 1?
What word is formed by unscrambling the letters iamgseo?
How do you change the wheel bearings in a Oldsmobile Alero?
When did Graham Martin die?
Where is shark valley and what species of sharks live there?
Does Uranus have snow?
What NFL teams did Randell Cunningham play for?
What is the significance of the upside down quarter note in music notation?
How do I measure correctly to order window treatments?
How do you fix a twisted ankle?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.