0
What else can I help you with?
Related Questions
Will there be zombies on mw3?
No, Treyarch owns zombies. Apparently MW3 will have "survivor mode" which is similar to zombies.
How do you get a predator missile on mw3 wii survival?
The predator missile is not included in MW3 for Wii.
Will there be zombies in MW3?
AnswerNo, because they are Nazi zombies and MW doesn't have any Nazi, but MW3 will have Special Ops and Survival Mode.
Is there going to be zombies in MW3?
Yes
Is there going to be a zombies on mw3?
Nope.
Is cod mw3 come Wii?
yes it is on the wii
Can you play infected on mw3 Wii and how?
You cannot play infection on mw3 wii version. But people found it by hacking.
Why does mw3 suck?
Because it does not have zombies :P
Does MW3 sucks?
Because it does not have Zombies :P
How do you play mw3 online for wii.Everytime I click multiplayer and play mw3 online it says mw3 update is available and something with the wii shop.I have internet.How do you play mw3 online for wii?
you absolutly can't
Will mw3 have lunge knife for wii?
no
Is there marine camo on mw3 for wii?
No.
Trending Questions
What is the term used to describe the ratio of force and the area on which it acts?
Who was married to Joan Plowright?
How much is a heat lamp?
What pushes food through the small intestine?
Is a tsunami a single wave?
When did Congo Bongo happen?
What is the of human population?
If the torque converter goes bad on a 4x4 Chevy Blazer do you have to rebuild the transmission?
How much money can you pay to bring 2 guinea pigs on a plane?
Which was the shortest month of 1988?
What is the Latin name for a house cat?
Where are beam bridges located in the world?
What is rai English?
What is the mRNA strand for ggctatatcctgcgctatacgcta?
What we breathe?
On a 69 Pontiac GTO does the vacuum for distributor come from above or below the throttle plates?
0.9 dm how many mm?
Does Jimmy Swaggart own real estate?
Does salmon give birth to young alive?
In a 1998 Nissan Sentra when you turn the steering wheel to the left or close the driver's side door the horn goes off what causes this?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.