0
What else can I help you with?
Related Questions
How do you say hand in Hebrew?
You say 'Yalda' in Hebrew
How do you find information about a word in Hebrew?
A good resource is Morfix. But you must know how to read Hebrew to use it.
How do you say has in Hebrew?
Has in Hebrew is: YESH
How do you say ceiling in Hebrew?
"Tikra" (תקרה) is how you say ceiling in Hebrew.
How do you say yes in Hebrew?
Ken and in Hebrew כן
How do you say 'boyfriend' in Hebrew?
"Boyfriend" in Hebrew is "khaver."
How do you say my in Hebrew?
The word "My" in Hebrew is pronounced: "Sheli"
How do you say mustache in Hebrew?
Mustache is 'Safam' in Hebrew
How do you say Partner in Hebrew?
Shu'taf is partner in Hebrew
How do you say network in Hebrew?
Network in Hebrew is 'Reshet'
How do you say torture in Hebrew?
'Torture' in Hebrew is עינויים.
What does Inawah say in Hebrew?
Inawah has no meaning in Hebrew
Trending Questions
Why did nurses wear white uniforms?
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
What would be difference of 2 rational numbers?
What part of speech is tattered in?
What are the mountain ranges in Greece?
What are some common uses of ununpentium?
What is 63 divided by 3825?
How long do you have to wait til you can take a pregnancy test and is there anyone that i can talk to about the whole thing because my periods are strange?
What is 216 in minutes?
What is Mary Summer's first name?
What is 21 15?
How do you put umlaut on letters?
How many calories in a Kentucky Fried Chicken biscuit?
What is the Distance from Newport RI to Mystic CT?
Does the white candle stay in the advent wreath all during the season or is it added later?
What it call subset of the whole numbers?
How do you pronounce Selkis?
What name for Jesus that means ''God is with us''?
What organs are used when you talks?
What is the size of the opening of a switch device box for a single device?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.