answersLogoWhite

Top Answer
User Avatar
Wiki User
Answered 2008-05-06 00:25:35

During transcription the DNA double helix is separated into two individual strands. Each strand may serve as a template for RNA polymerase, which travels along the DNA structure in a 3' to 5' direction. As it progresses down the strand, RNA polymerase synthesizes a pre-messenger RNA strand that is complementary to the sequence on the DNA template. For example if the DNA sequence on the template was 5' ATACA 3', then the pre mRNA sequence synthesized would be 3' UAUGU 5'. (Remember, RNA synthesis utilizes the nucleotide uracil instead of thyamine).

001
๐Ÿ™
0
๐Ÿคจ
0
๐Ÿ˜ฎ
0
๐Ÿ˜‚
0
User Avatar

Your Answer

Still Have Questions?

Related Questions

What sequence in mRNA complements the sequence in the DNA template?

4


Is there a template for transcribing original DNA to base sequence of RNA?

DNA is a template for making RNA. I hope this answers your question.


What is the term that describes the sequence of DNA that a restriction enzyme finds and cuts?

Template Sequence


What is compatible to TCGTA in a sequence template in DNA replication?

AGCAT


What strand of dna would be produced from the template strand of dna called aacct?

A binds with T, and C binds with G. Meaning the strand of DNA produced from the template AACCT would be TTGGA.


How do you determine the sequence of bases in a complementary strand of DNA?

If the nucleotide sequence is cggattacaaactcggctaggcttgtagggctattgttgcg How would i determine the sequence of bases in the complentary strand to the DNA template strand?


Which of the following best describes how mRNA is produced?

for apex, it's DNA provides a template for RNA polymerase.


What is the sequence of the template DNA?

What do you really want to ask? template DNA is a DNA you want to amplify. So you should know what you are amplifying before a PCR or you can make it by sequencing your PCR product.


What determines the nucleotide sequence of the newly synthesised strand during DNA replication?

The template DNA strand.


What strand of DNA would be produced from the template strand of DNA aac ct?

Ttg ga


How does the code in DNA relate to the amino acid sequence in a protein?

The amino acid sequence comes from an mRNA transcript which is synthesized from a DNA template. So DNA makes RNA makes proteins.


What protein sequence would be produced from the following DNA sequence ACGTAAGCATCG?

TGCATTCGTAGC


What strand of DNA would be produced from the template strand of DNA using AAC CT?

Ttg ga


The synthesis of an RNA molecule from a DNA template strand is?

transcription:"the first step in protein synthesis, a sequence of nucleotide bases becomes exposed in an unwound region of a DNA strand. That sequence acts as a template upon which a single strand of RNA - a transcript - is synthesized from free nucleotides."The synthesis of an RNA molecule from the DNA template strand is called transcription.


MRNA sequence. 3' GUCAGAUGGAUAACUCAUGACAGGUACCA 5'determine the template DNA sequence?

5' CAGTCTACCTATTGAGTACTGTCCATGGT 3'


Mrna sequence 3' aacuaccga 5'determine the template DNA sequence?

The template sequence would be 5' TTGATGGCT 3'. You can find any DNA template sequence by finding the complementary base pair sequence for the mrna sequence. To do this, remember that A matches with U or T (U is used in the RNA strands wheras T is used in the DNA strands) and G matches with C (and vice versa). Next just flip the 5' and 3' ends because the complementary strands are always antiparallel to each other.


What is directly formed from this template of DNAserves as the template to initiate protein synthesis?

The intermediate molecule formed between DNA and protein is mRNA (messenger RNA). The process in which the DNA sequence is copied to an RNA sequence is called transcription. The process in which the mRNA template is read to produce protein is called translation (protein synthesis)


What strand of DNA would be produced from the template strand of DNA?

AAC CT would produce TTG GA The coding strand is the DNA strand that has the same base sequence as the RNA transcript. It contains codons, and the non-coding strand has anti-codons instead.


How is mRNA produced in a cell?

mRNA is made by RNA polymerase, using DNA as a template.


What is the base sequence for RNA after transcription?

It would have the complementary sequence to that of the DNA template strand from which it is transcribed from except that instead of Thiamine, u will have Uracil bases.


What is the DNA template?

DNA is double-stranded, but only one strand serves as a template for transcription at any given time. This template strand is called the noncoding strand. The nontemplate strand is referred to as the coding strand because its sequence will be the same as that of the new RNA molecule.


What initially determines which DNA strand is the template strand and therefore in which direction RNA polymerase ii moves along the DNA?

the specific sequence of bases along the DNA strands


Is the condon the sequence of the three nitrogenous bases in the DNA template that signal the beginning of a gene?

That would be a start codon.


Rna molecules are produced by copying part of the nucleotide sequence of DNA into a complementary sequence in rna?

transcription


RNA molecules are produced by copying part of the nucleotides sequence of DNA into a complementary sequence in RNA?

Transcription


Still have questions?