0
After ruling out trauma to the brain from accident, disease, or stroke, most people who have experienced TGA receive very little treatment because the condition is benign
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
What is the prognosis for TGA patients?
The prognosis for TGA patients is excellent
What is the different between TGA and DMTA?
TGA: ThermoGravimetic Analysis DMTA: Dynamical Mechanical Thermal Analysis
What is TGA?
Transient global amnesia
What is the market cap for Transglobe Energy Corp TGA?
As of July 2014, the market cap for Transglobe Energy Corp (TGA) is $504,566,469.56.
Drug regulatory authority in Australia?
TGA
What is the prognosis for the patient?
The prognosis for TGA patients is excellent
What is an aruding?
aruding is a Apenas Rodolfo tga camanjac....
Full form of TGA?
Tarun gelo agartala
What is the real name of Subcool of TGA Seeds?
Brian Rutherford.
How do you add tga badges in fifa manager 2008?
a now
Consider a strand of DNA with this sequence AAA tga caa cta cca tct tga gca aca aga what is the corresponding sequence of the other side of the DNA helix how would you get the answer?
tttactgttgatggtagaactcgttgttct
Full form of tga transcription factor?
The full form of TGA transcription factor is "TGA-interacting basic leucine zipper transcription factor." It is a type of transcription factor that plays a key role in regulating gene expression in response to various environmental stress factors in plants.
