TGA: ThermoGravimetic Analysis
DMTA: Dynamical Mechanical Thermal Analysis
The prognosis for TGA patients is excellent
Transient global amnesia
As of July 2014, the market cap for Transglobe Energy Corp (TGA) is $504,566,469.56.
TGA
The prognosis for TGA patients is excellent
aruding is a Apenas Rodolfo tga camanjac....
Tarun gelo agartala
After ruling out trauma to the brain from accident, disease, or stroke, most people who have experienced TGA receive very little treatment because the condition is benign
Brian Rutherford.
a now
tttactgttgatggtagaactcgttgttct
Referring to the TGA1 article in Plant Cell in 1992 by Schindler et al., TGA is an abbreviation for the DNA motif to which TGA1 binds. The authors show that TGA1 binds preferentially to TGACG motifs. Thus the full name should be TGACG motif binding (TGA) transcription factors. Mark Z.