0
From Saudi Arabia it takes 14 hours
What else can I help you with?
Related Questions
How long does it take to fly to US from Egypt?
It takes about 12 - 13.5 hours to fly to Egypt from the US.
How long does it take to fly from the us to china?
22 HOURS
How long does it take to fly from the US to Mozambique?
16 hours
How long to fly from Japan to US?
13 hrs from atlanta
How long it takes to fly from England to US?
16 hrs
How long does it take to fly from Switzerland to US?
About 10 hours.
How long to fly from Adelaide to Nevada US?
1 year
Can you use a foreign passport to fly in the US?
Yes, you can use a foreign passport to fly in the US as long as it is valid and meets the entry requirements set by the US government.
How long does it take to fly from Japan back to the US?
6 hours
How long does it take to fly from the US to Bahrain?
7hours 13 minutes
How long does it take to fly from Penang to the US?
It depends on where in the US, but it will take about 18 hours and 20 minutes.
How long does it take to fly from Manchester to Denver US?
about 8 and a half hours
Trending Questions
Tattoos that represent travel?
Which of the events was most influential in bringing the US into the world war 2?
What were the elements and functions of god myths?
Give two types of evidence for continental drift with an example of each type?
When you rate their depression on a scale from 1-10. their response are what in your study?
What is the distance between the points (1 -2) and (-93) on a grid?
Why were marriages arranged in Shakespeare's time?
Why does carbon conduct electricity if it is a non metal?
What should you do if the application of one Combat Application Trouniquet does not stop bleeding?
What is minimum age of a imam?
Would mung bean grow without water?
How many amps does a one horse power motor draw?
How long will it take to run 1.5 miles at 7 miles per hour?
Is sign language a forgen language?
What language do Wales people talk?
What is a catchy title for a science fair project on heat?
What words have the same vowel sound as the word ground?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What is the common name for the spine?
How many people use health app from their cell phone?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.